Canis_familiaris Locus Poly:6:SNORA17
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:6:SNORA17
Canis_familiaris
Poly:6:SNORA17
9
SNORA17, SNORA43
1001..1133, 1878..2013
3013
GCGCTGGCGTGCCTGGCGCTGTTCGGTGTGCCTTGCGTAGACTGGCTCGGGCGGTTCGG
CGGCTCACGGATGTAGGGTCACTGCGTATTCCATTTTGCCGCGTCCCGCCCTAGGGGGAA
GGAGAGCCAGGCTGCGGGGCCGGGCTGCCTCCGCCTTGGGAAGGGGTCTCGCTCCGGCCC
CCGACGCGCTGACCAGGGCCTGCGAGGCCTGCCGCGTCACGCCAGGGAGGGCCCGCTAGA
GGGCGCCGCAGCGGGGGGCTCGGGACGGTGTTGTCTGACCCTCGCGGGCCGCCGTACGCG
CTATAAAAGGCGCGACGCGTGGGTGTGCGCCCTTTCTCGCGGCGGCGGGGCGGCGGTGCC
TGCTGGAGGGTGCGCGGGCCCGGCTCCCCTCAGGCAGCGGCTCGCTAGCCGAGGTTTGGC
GCGCAGGGCCCGGCTTTCCGTGAGTCCGCGCTCGGGGGTGAGGAGTTGCTGTACTTTTGT
TTGGAAAGGCGGCCCGGTCGTTATTTCGTGCGTTGTGGCCAAACGTAGGGCGGCGTCCGC
GTGCCGCGGTGCCTGGGTCCCTCCCTGGCCGCGCCGCCTGCCGCAGAGGTGCGGGCGCTG
CCGGCTGGAGTGTGTGCACCGGCCCCAGCGGCTGGCACGTCAGGCGGGACCCGCGCCCCT
GACCCCGGTGTTGCGCGCGCCAAGCCGGGTTGGCGGTGGGAGTTGAACGGCCCGGTGTAT
TCTGGGAATACACGGCCCAGGTGGCAGGGTCTTGGGGTTGCAAACGCAGCGGAGCCGTGT
GGGTGCAGAGCTCCTTTGCGCACGTGTCGGGTTTCTGAAAAGGGTCCGTTTCTTTTTTTC
CTCTAGGGAGCTTTCCTGCTGGAAACCCGGCCTGGAAGAGCGTCCTGGGATCTCGGGTGA
GTTGACAGGTTAGTGTCAACAACTAACTAACTGTTGTTTGCAACTTCAGCGCTTTCTGTG
CCATCTCCTGCAATGGGGTAGGTAGGTGGTCCTTCGTCTCCACTGCCCCCAGAGGCGTTG
CAGGTGTGGCTGCATCTGTGTCACATTTGTGTCATTGGGTGGCAGAAAGAAGAGAGGCTT
ATCTACGCCCAGTGTTCAGCTGGTGAACGTCTGGATGATTAATAGTCTGACACTTGACAG
TGCATCTGGTGGTGCCTGTTTGCTGGCAGCCTCAGGCCACCGTGTAAAAGCCCTTGGATT
GGCCTAGTTCTTGGGTAGCCCCCGATGGGGACGTGGGTCCCTCAGAGTGCAGGTGGTCTG
ACTTGCCGAACATCTCAGTTATACATATTTGTCACAGTGGATGAAACAAACGATGGCGCC
TGATATTTTCTTTTTGGGGTTAAGTGAACACCACAACCTAACAATCCAGTAAAGTTCAAA
TTAATTCAGATTAAAGAAGCTCAGGTTGAGAGGGTGTGGGAGTCCCTAAGAAAAGCCATC
CCAGGTGCATCAGCCACTAAGCTACTTCCGGGTGCCAGCGCTGGCTGTCCAGGTCCATGA
CCTCCACTTTGGGCTGTCTGCCAGGGCTCTGCAAGGTGATGGCAGAAAAGGTAAAGGACG
CTATTCATAGTTAACTTCTGCCACCTGCCTGGCCAGCCGGTCAGGTTCTTCAGAATCCTG
CAGAGGTGGTTTACTGGCCCCTGGTTGGGTTAACAATAACAATGACAGCCAGCTTGTATT
CTACTCTGATTTGGGCCTAAGCATTTTTATTACTGTTACAGGAAGGAAGGTGATAGCTAG
CCTGTGAAGGGGGCCAGAATAAATGACCAGCACCATCCAGAAGAAGGTAAGAGGAGAAAT
GAGGCTAGCTCCCCCCTGGGGGGAGGCCATATTCCTGGGCCTAGCCAGGTGGGAAGGTGG
GAGGGACTGGCTGCCCTGCAGGTGCTGGACCTACTAGCACCACAGATACAGCTGCTTTGC
TGCACCTGGGATGTCAGGGCAAAGAGGAAGTGGCTATTTCTACGCTCAGTGCTCAGAACA
GTGGGCACTAAGAATGGTTTGTAGCCAAACATGCCTCAGCTGCCGTGGACGCGGTTGCTA
CTACGTGCGCTCGGCAGGCACACCTACCCTGGGCTTCTGCCTGGGAATGTGGAGCCTGGC
ACCAAACGCTTTTTCTGATTTGTCTGTAAAGAGACCCTTTATGGGAATTGAGTGCACCAT
GCATGTATATGAGCTTTTGGCACAGTGGGATTGACCGGGAGGAGGTTTCTTTCCTGAAAA
CAGTCCCTCTGTAGGTCTGTCTGCAGAGGGCTTTCTGGAAGTCCTTGGGCAAGTGTGTTG
TGCATCCCTGGCTGAGAGCTGCTATGAGTGGCCTGTTGTCCCTCCCTGTGCCTCCAGACC
CCTGCTTTAAGGACCCTTTGAGAGGAGAGGATGTCTCGTCAGGCTGGGGATGGGAGGGAG
GCCAGAGGGCTGCACCTGGCTTTGTAAAGGTCAGGCCTGTGTGGAGCCCAGTAAGCCATG
GTCCAAACCAGGATGCTGGTGAGTGGAGGGATATGACTGGGGCTGTCCTGCCTCCTTGCA
GGTGGAGAGCCCAACACCGGGATGAGTACACAAGACTGGGGCTGAGAGACCCACTGATTT
CAGGTGAATAAGAGTAATATGTGTTGCTTTTTTTTTTTTTTTTTAAGGCATTTTTGCAAA
ACGTTGAAAAGCAGTTGAGTGTGCTCAGCTGGAGTTTGCCCCCATGAGATGGCTCTGTTG
GGGCCCACGCAACAGGAACCCTTAAGAGAAGGGCTTAGTAGAGACTGTTCGGACTCCAGG
AAATCCAAGCAGGCTAAGGCTTAGGGAAGGGGTCCAGACAAATGGGGCGTCTGTGCCTTT
GCTTCTGATGCAGTGATGATTTGCAGAGGCACCCCCCAGTGGCCAGTGTGGCCCTGGCTC
TGCTCTCAGTTGCCTCAGGGACAGGGCACACCCCAGCTTGGAGGTGCCAGGCCTTCATGT
GTCCTGTGTGCACCTTGTGTCGGGGGCTGAGGATGAGGAGGATCTTCCCTGCAGGGTCTT
GGTTCTTAATCCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved