Canis_familiaris Locus Mono:29:SNORA61
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:29:SNORA61
Canis_familiaris
Mono:29:SNORA61
5
SNORA61
1001..1132
2132
AGGTTTTAAATGCTGAACTAATGACTCTTGCCTTAGTAAAAGTCACCTCAGCTTCTTAG
TAGGTGCAGTCCTCTGTGTGACAGGTACAGAGGTTGGCAAGAATTTTCTACAAAGGACCA
GATAATTTTTCATCTTTGTAGCCACACATGGTCTCTGGTCACATACTCTTTTTTTGCTCT
ATTTTTTGTTTGTTTTTAAACAACCCTCTGAGAATCTAAAAACCTTCCTTAGCTCCCCTG
GCTTATGCCAGCAGGATTTGGTTCGTGGGCTATAGTTTTCTGACCCCTGAACCCACTTCC
TGGGCACTGTAATCCTGAGCACAGTCTCAAGGTAAAGCTAAGATTGGTGCCACTACTGAA
GACATTTATTATGAATTACTGTATAAATGAATTTCATCAGATTAGTCAATACTACATTTT
AAGCATGGAACACAGAGATCTGTCCCACAGTAGAGTTCCAGAAATTAAGGCTAGGAGTAA
CATATCAGAATTGCTTTTAGTTGCCAGTGACAGTAAAATAGACAGGCTGCTTTTTAAAGA
AATGTTATTCTTCCTCAACTGACAATTCATCCAGACAAAAGCAATCACTAGTATTTGTTC
TACTGTTCAAAAATGTCATCAAGAACCCAGATGTTTCCTACTCTCCTGCTCCACCACCCT
TTGCATGTAGACTTTTCATTCTCATTCTTGATGTCTCCTATTACAAGGTGGCTGCTGCTG
CTCCAGATATCTTATCCCCATACTAGTGTCTCTAGCTGGGAAAAAAGGAGCAGAATCTGT
CTTTTCATCAAGGAAATGAAGTTCACAGTGGATTCCTCCTTGTTTCTTTCATCATACATG
GGGGTACATACTATGGTAGGCAGAATAATGGACCCCAAAGATATCCACACTCTTATCCTT
GGAACCAATGAATATGAAGGAATAATTAAGTTTGCAAACCTCAAAACAGAATATCTAGGG
GCTGCATAGAACCACACAATTCCTTAAGAATAGAACATCCAACCCTCTGGTTCCCTTTCC
CATCAGATCTATTCGCTGGTCTTGGTGGTTGTAAAAGGAGAAAAAGGAACAATGAAGCCA
GCCTCCCAGTGCCTACAGTCTGGCATATAGCTTTTGGGCTGTTTCAAATGAGATCTGAAC
TTAAAAAAAAAAAACAAAAACAAAAACAAAAAAACCAGTATCTACTCTGGCCAGAGCAAG
AGAAATAGAGCAGAAGAAATAAAAAAGATTCCAAGTGTTAAGGATTCAACACACTGTTAC
TTTGTCAGAGAGGTAAGAGTCTGTGTGCAGGGTCTAGAGAGAAGCATCTGTAAGCTGGAT
GTAGCCCCCAGCTGATAGCCAGCAAGTAAGTGGGGACCTCAGTCCTACAACCACAAGGAA
CTGCATTCTGCCCACACTCTGTATAATTTTGGAAGCAGATCCTTCCCACAGTATCCTGAT
CAGGTCCCAGCCAACTGACACTTTAATTCTGTCCTTATAAAACTCAGAGCAAAAAAAACA
AGTGAGCCAACCCAAACTTAGGGCCTACAAAACTGTGAGACAGTTATCTGTGCTAATTTG
TTAGAGCAGCAATAGAAAACTATTACACATGCTTACTAGTCCAGTCAATCACTAGCTAAT
GGGAGTGGGATTGCCATGGCAGCTTTAGGCTAGTCATGCTTAATTCCATGGGTCTGAGAT
GAGGCCTATCCTCCCTGTGATCAAGAAACCTGGATAGAATACACTCTACCTGGAGAAAAG
TAAAATTAGGGTTCTATTAGCCAGAAAAACAGGAAAACAGCTGTTGAGTAGACGAGTTAA
CAGCATACTCCATAAGTGGGTTAAGCACTTGATCCAGCTGGATTTATCTCAAAACCTGAG
AAAGAGAGGCACCTGGGTGGCTCGATGGTTGAGCATCTGCCTTTGGCTCAGGGTATGATC
CCAGCATCCTGGGATCAAGTCCCACATCAGGCTCCCCACAGGGAGCCTGCTCCCTCTGCC
TCTCTCTCTCTTGAATAAATAAAATCTTTAAAACAAAAAACCCCAAGAGAGGGATGCTGG
AAGGATGAGCAATATTATAAATGAATAAAGCATTGAAAGGTAGAATTTTAATGGTATTTT
GTATTTGCTTCAAAATTCCTCAATCAGAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved