Canis_familiaris Locus Mono:65:SNORA16
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:65:SNORA16
Canis_familiaris
Mono:65:SNORA16
25
SNORA16
1001..1129
2129
GCTCTATGGATTGAGGAAATAGTACAATAAGGAAAAACTGATCTAATTTCTAATTGTTC
TTTTGTAAGGATCTCTGTTGCATCATTATGGCTTGGGGAGAAGGCTGTTTTTATCAAGGT
AAGAGCCTGGGAAAGGGGGAGAGAGAAAGGAAAGAAAGCCCACATTTATTAAGTGCTGAC
TGTATGCCTGGCACTTCTTATATGCTGGCTTATTAGATCTTTACAATAACTCTACGATAC
AGTCAATTTCATTTTATAAGTGAGGACGTTAGGATCAGAGGATTACACATTTGCTTCAAA
GAGTCCAGATTTCATAATACACAAAGTGGTCTTACCTTACTAGGCATGTTCATGAACAAA
CACACCTACATCCACTTTTCACAGTTAACGAGGGAATCTTGTTGAGGTATGATTATATAG
CTAGGAGGTTTCAATGTTCTTTTTCCACACTTCTTAAGGGTATGATGAAGCAGCAGGTCT
GAGAGGGGGTTTCTCTGCTTCCTAACATTATGCCTTTCCAACATTCTTTGCTCTGTACTC
TGGCTTTTTTTCTCCCTTACATTAGCACCACCTGACAGATGCTTACCTATTATCTATTTA
TTTTACTAGGAGGTAAGCTCTGTGAGATGAGATGTGTCTTAAGTTCTGATATGGGAAAAT
GTTTTCAGCTTCTGAGAGAGGTTCTGGCACCTTGTAGGCCTAAATCACTAAATAGTTGCT
GGATTTATTAATTCCAGGAGCTTTCTACGAGATGTCTGCTCAGTTGTCCTCTCAGTTGAG
TAAGCACAAAAGCAAACAGAAGATTATTCACCTAAAGAGAGTTAGTTGTAAAACAATGAA
TGGGCTGTAGAAAATAGACAAGAGCAAAAAAGGGGTACAGCCATCCCCTCCAAAGTCCTC
TTCCATCAGAGCACAAGAAAACCATTCCTGTGTTTTACACGTGAAGACATGGGATGTGCC
ATTTCCACCACCCAGTAGTTACACTAAAAAGAGGTTTAAAAATTAGAATCAAAGATGCAG
TTGCTTTCACATAGAAGCAGCAGTCAGAAAAGAGCCTAAATGACAGTTTTCCTATTCAAC
CACTGTTCTGTTGTCTGTAACTGACTTATGACATGTTGGAAAACACAGCTGAAGACAAGT
TAGCACAGAGGTAGGTGTGCTTCTGGTTCTTTTTCCCATTCTGAGCACCACAGAATTGAC
CAACAATAGAAACAGAGGAAACCAGTACTGTGGCTAGATTCTACAGAAGGGAGCTATTCA
CATGAAAGAGGAAGGAAGTTCTTCCAGATAACGTGGAACGGGACCACACTGGCACTCGAG
GGCTGAGTCTGGTTTTGGATCTGATGAACATGCCCTACTTGAGAGGCAGCAAGGGGAACG
GCAAGAGGGAGTGGTAGGACAGTCTGGGAACTCTTCGCTGAAGTCTTCTTAGCCGCTGGG
GCTTGATAGTGTCCATGGGGCCGGCAGAGGTTGAGCTCCATCTCTGCAAGGGCAAGGCTG
AACCTTGGCACGGTGTTTGGCAGCGCCAAGAAGGTCAAGCCACACCAGACTTGGGGGAGA
ATGTCCCAGGTCATTTGCTGTGGCTCCCACCCCATTCTCTTCAGGCTGTTGAGTCATAGA
ACTTAACTTATTCCTTACCCACCCCCACCCCCGCCCCCCACCCCAGTTTAAAGTCCTTGA
GGAGAATACCAATAACATCAGAGAAAGTGCTGAAATCCAAGAAGAATACTCTCTTTCTGT
CTCCTTTGGGAGGTAAATCCAAGGTTTGGGTAAAATTCTCAATGTACAAAGATGAGTAAC
TAGAAATTCTCCTCACACAGTTTGGGGCTGTATAAAAGGAGTTTGCATAATTAAGGCAAC
GGAGCCTAATATTCAAGAATCATTCATATATATCCAGCAGATATTTATTGAATATCTCTC
ATGTGCTTGATATTCTTCTGTTTGCTCAGAATAGAGCAATGAACAGAACAAAAATTCCTG
CCTTCATGGAACATATATTCTATCGAAGAAAAAAATTTTCTGCAGGGAAGAAGAAAAACT
TTAAATAACATGGGCTCTGCTTTCAAAGAACAAACAAAAAAGAAGTCCATCACTATTCTA
CTTGATGTATATACTCTCAGGCACTGTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved