Canis_familiaris Locus Mono:6:SNORD35
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:6:SNORD35
Canis_familiaris
Mono:6:SNORD35
X
SNORD35
1001..1087
2087
AATGGTGGCTACCAGGGACTGGGAACAGGAAAAATGAGTTATTGTTTAATGGGCACAGA
GTTTCAGTTTTACAAGATGAAAAAGTTCTGGAAACCTATTTCACAACAAGGTGAACACAC
TTAACACCACTGAACTACACGCTAAGAAACAGTTAAGGTGGTAAATTTTATGATGTGTAA
TGTTTTATCACAGTAAAAAAAAAAAGAAAGAAAGAAAAAGAAAAAAGAAACACAATATTA
CCAGCTCCCCCAGAAGCCCTCCTGCCCCTTCTCAGTCACTTCAGCCTGTCCAGGAAAACC
ACTCTTCTGATCATCAGAAAGAGCCTGTCTGTTCTAAAAAGATCCTAGAGTTAGTAAGAA
AGAAAGTGTGCCAACCCCCTTTCCTTCTGAGAGGGAGACTCCTCAAAATCAGACAAGGAT
TTGGTCGTGCCTAACGCATTGCAACGCATTGCCTGGCATATAGCAGAAGTAGCTCAAAAT
TGCATGCTGATTCCATGTGGACACCGGCCGGGGAGATGCCAAGAGAAGGGAAGGGCACCT
GAGAAAGAAGAGACAAGTGCTGGAAACAAACACCAGCTGCTTTGCAATCTTGCCAAAGGT
TAGCCCTGCATACTCATTACAGGTTTATTCACTGATGATGCTTTTTTTTTTTCTTTTTCA
CTGTGTTGACAACATGACCTGTAGGTTCATATTTGAATCCAGCTCAAAGTATATATTTTT
GTTATTGTGTGCACAGCACTATGTGCTTATTTTCTTTCCAGGGTGTTTATTGCTACTATG
TATGGCAGGAGACAAAGCAGGTGTGCTTGCTAATGCCGGCCTCCAAATTCCTCAGGGACA
AATTCAAAACTCAAGGAAATTGAGGTTCGCCTCATTTTACAACTGCCATAATATGTGATC
CACTAGACTTTTTCACTATGTTCTTTTCCACGATGGCACCAGATGTTCTAATGAACAAAT
AACAACACTGTAAGTGCCGATCAAGAAAATGGATAAAATTCAGCAGATGATGGTTTTTCC
TCATGATAGTCTGTGGATGACACTGTGGGCAGCAGCGGTAACACCAATGGCTCAGCTGAT
GCCAGGAAGGGAAAAAAGAAGAAGAAAGAAAATGGATACAATTGTTATTTTAGGCCACAA
ATGGTAGTGACTGGGGCAAGAGTTCAACAATCTACTTATAGTCTTGAGGCCAAGGAAATA
TGATGCACCACTCTTTGATGTCAGATGGCAGGCAGATATGCTGGGGACCTTGGAAACAAA
GATGGTATTGTCATATTATGCTAAGGATTAGTTATTTAGATTACTTATTGGGTCTCAGAC
CCAATGATTCCTTTAATAACATATATTCAGGAGTCCTCCTGCACTAACCTGAAATAAAAC
CCATAGGGAATACCACATACCCCTATGCATAATTGTAAAAAAAAATCAACATAATACCCT
GGCAGAAAAGGACAAATAGAAAGAAAGTAATGAAAAAAAAAAAAGAAAAAAAAAGAAAGT
AATGTATAATAAAATAACAAACACCTCAAAATTAAACTCTCAGACATGGCAATCCTAGAA
GACAAAATAAAGTAGCCAAATGCTTACACTATCATAGCATCGGTGTGAGTGACAGCTCAA
GGCCAAGACTGACACAGGTATGCTTTAGTGGCAACTTGAAGGACAAGATCAGTACTGCCC
ATGGTGTTATGACTTCCCAGCATGGTGAACAACACTGGAAAAGTTCTAAGCAATACTAAA
GGCAAGCATCCTTCAATTTATACTGTGCCTGCATTCCTAGAAAATTAGAGGCTTATTTTT
ACCTACATGATGGTTCAGTAGGATATCTGAAGGTCATTCAGAACAGGGGGTGATTTCCAG
TTCTAGCATCTCTGACCCCAGCCTTTAAATGTCAATAGTGCTCCCCAATCATTGTGACAA
CAAAATGCCACTATTGATTTTTTTTTTATTTTTTTTTTAAATTTATTTATGATAGTCACA
CACACACACAGAGAGAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCAC
TGGGAGCCCGACGTGGGATTCGATCCCGGGTCTCCAGGATTGCGCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved