Canis_familiaris Locus Mono:79:SNORD18
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:79:SNORD18
Canis_familiaris
Mono:79:SNORD18
3
SNORD18
1001..1068
2068
CTTCTGATTCCCTTCCAGTCACTATGCACTAGTCCCATCCTATACTTAATAACCACTAC
CTGGGGCAGCCCGGGTGGCTCAGCGGTTTAGCGCTGCCTTCAAACGGGGGTGTGATCCTG
AAGTCCTGGGATCAAGTCCTGCGTCGGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCC
TGTGTCTCTGCCTCTCTCTCTCTCTCTGTGTCTCTCATGAATAAATAAATAAAATCTTAA
AAAAAAATAACCACTATCCTAACTTCCAACAGCTAAGATTAGTTTGCCTGTTTTTAAACT
TTGTATAAATGTATTTATATACAACATCTTGTTTTAATCTATATTCTTTCACTCAACATT
GTGTTTGGGTTTTTATAAGGAGAGTTTTTTTTTTAAGATTTATTTATTTATTTTGAAAGA
GAGAGAGCACAAGGAGAGGGGCAGAGGGAGAGAAGAAAAAGAATCTCAAGCAGACTTCCT
GCTCAGTGGGGAGTCCAACATAGGGCTCAATCACTCCACCCATGCAACCATGACCTGAGG
CAAAATCAAGAGTCAGAGGCTTCACCAACTGAGCCACCCAGGCACCTCTACTCAACATTA
TATTTATAAGAATCATACATGTTGTTGCCTACCATTATACATCACTGACTCTCACTGCTG
TGCTGTATTCCACTGAATGACTGTATCACAATTTATTTATCCATTCTTTTGTTAATATTC
ATGTGTGTAGTGTCCATGTTGGGGCTTTTATGAAGAATGAACATACATTTTAATTGAGTG
TATTTCTAGGAATGGAACTCCTGGGGTATATGTTTTGTGTAGTTCAATTTTATCAAACAC
ACCAAAGACTCTTCCAAGTCTTTACACCCCTCTAGCAGTGTAGGAGAGTTCTAGTTGCTT
CACATCCTCCATAGCACTTGGATTTTCCACCGTTTTTATTTTATTTTACTCTAGTGAGTA
TGCAGTGATATCACATTGCAGTTTTTCATCTGCAATTTCCTGATGACTAACGAAGTTAAA
CTCCTTTCTCTGTGTTTATGAAACACATGAAAGAGAATATTTTGATATGTTCTTTTGTAA
AGTGTCTATTCAAGTGTTGTGTTTATTTTTACATTAGGTCATATCTTTTTCTTATTGGTG
TGGAGGGGTTAAGTATGTATTCTGTATACAAGTCCTTTGTGAGAATTCTATTTTGCTGAT
AGCTATTTCCAATATCTCACTCCATGTGTATTTTTTGAAGAATTTTTCTGCCTGAAGGCA
CTATTTCAGGTGGGTTCTTGGGCACCTGGGGCTAGTGACAGCAGGGAACTGTTCCTGCTC
TGAGGATGAAGTTCAAGGGGATGAAATTGTATTACTTGAGCCCAGGGAGGGCTGGATCTG
GGGAGGTGGGGCAGCTCAGCTGGAGTTATGGTCATGAGGGCCACACTACTGCCAGGTGCA
GGCCTGCAGCAAGGATGAGTAGGAAATCCCCCTCTCCTCTCACTTTCCTTTCTCCTGATG
GGGCTTCCATTAGGTGAACCCAGAAATCAAAAAGGAAACCCAAAAGGTGTCATCCTCAGG
AGTCAGCCTCTGGATCACAGAGGAAGACAGAGAAGGAAGAGGCATGATCAGGGCCAGGGG
GTGCCGTGGAGATTAACCAGCAAAGAGAAGGTACGAGAGACTGCCCAAAGACTGTATCTC
TCAGGTTAAGACACTATGCAGTGTGTATGTCCCCAGGGAGCCTCAAAAGAATCCGCAAAA
TGTGCTCCTTGAGAAAGCCAGCATTTGGAGGATTGCCATGTGGGAATCTGGCAGCAGAAC
TAGTTAGGTGAAAAAGAAAAAAGATTTTTTGCTCCCTTCCTAGATTAATCTTCTACTTCC
TTTGCCCCAAGCCTAGAGGAGCCAGGAAAGGGAGAGGAAGGGAGAGAGAAAACTCCTGAA
AGGACACCCGATGACCCTCCCTACTGCCTGGCTGGGCCAGAGCAGAGCTGGGCTTGGATG
TGAGATTCAAATTTTGATTGAGACTGGACTGACTGAATACCTGAAAGCGAGTCATCTTTA
TAGAAACAAGACTTATTCCTACCATTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved