Canis_familiaris Locus Mono:23:SNORA74
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:23:SNORA74
Canis_familiaris
Mono:23:SNORA74
11
SNORA74
1001..1201
2201
ATCTTTTTCTTTTTTAGGATAACTTGAAAGTAGGGCATGTTTGGCCCTCCTGAAGAGAG
AAAATTAGTGGTTGGTGAACAGTCTGTATGGCATTCTCAGGTAATGTCCCTTTTCTTTAC
TTTTCTTTTTTTTTTTAATTAATTAATTAATTTATTTATTTATTCATGAGAGACACAGAA
AGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCATGCAGAGAGCCTGATGTGGGACTC
GATCCCGGGTCTCCAGGATCATGCTATGGGCTGAAGGCGGCGCTAAACCACTGAGCCACC
CGGGCTGCCCATGTCCCTTTTCATCCAACAGGGACTACTTCCTGTGTGGCAGGCCTGTTT
GCTTGTTGGTATCCATCAGGAAACCATTGGGTGGCACAATCACCTTATATCTGTCCCCCA
ACAAATTTGGCCTCTGATCAGTGAAAAGCTAAGTGTGATTTTGGTAGCTATGGTCTAAGG
CCTGTAAGATCTTTGAGATTATCTGTATCATTCCATCTGAGGATTTTTTTTTTTTTAAGA
TTTTATTTATTTATTCATGAGAGGCAGAGGTAGGCAGAGACACAGGCAGAGGAACAAGCA
GGCTCCACACAGGGAGCCTGATGCAGGACTCAATCCTGGGACCCCAGGGCTGGGCTGAAG
GCGGTGCTAAACCCCTGAGCCACCCAGGCTGCCCCCATCTGAGGAATTCAGAACAAGATT
ATAAAAGTCCAGGATAGAAAGGATGATGTATCTTGTGTGGTCACTGCTAAATCTCAATCC
TAGTGCCTGGCACATATAATAGGAATTCCCTGAATGTTGGACCAAAGGGATGGGAAAGAG
GTTCCTGTTTCCTATTTGTTCAAATAGTTTGGCACCAAAGTCTGCCATCAGTGCTTCCAG
GCTTCTGGTTGGCATCCCATGTTGAATTCATGGGGATACGTGTATCCATATCTTCTACTT
GGGGTGCCTGCGTATCTGAAACAAAGCTGTTCCAGGAATCACCCAGCGGTTGTCAGCTAT
CCAGGCTAGTATGTTGCCTTGGATGGTGTTACACTGTTGGAAGAGCAAACACTGCCTTTA
TTGAGGTCTGGCTCCGAGCACTGTTTTGGTGTTGCAGCTAAGTACTCTTGGGCAGCGTTT
TGCACCTCTGAGAGTGGAAGAACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACA
GTTTTTTTTCTTTTTTCCTTTGAGAAAAGGACTCTGTCTGAGGCTCCTTTGGATCCTTCT
TTGTCATTCCTTTCCTCTTTGAATCCTAGATGCCTTTACCTGAGGGAGAAATCTGCCTCC
ATTCAGACCTCAGATGTCTCTTGACAGCCCTATGTGACACTGGGATAGGTAATGTATATA
ATCCTTTTGTCACGTAGTTCTAATTAACTTGTTTCAGCTCAGATGGGTGGTGTGAAGTAA
TAGAAAATTATATATTGGCCTCTGCTCCCATTCTTGGCACAAAGTTCCTAAAACTCTTAA
GATTCCCTAAGCAATAAGTACATTAGGAGCATCTTTTGTTCTGCTATTTGGTCTTTAACT
CTGATTCCTGGGTGATAAGCATGTCTTGTTCTAATGAGGTTGGTCACCAGAAAGGCCACA
CAGTGATTAGAAGCTTGGAATTTTCAGCCCCACCACGATTCTTCAAAAGGGGAAAGGGGC
TGGAAATGGAGTTAATAATTGATCATTCCCACATGATAAAGCCTCCGTAAAAATCCCAGT
AGTGTGGGGTTTAGAGAACTTTTAGGTTGGTGAACACATGGAGGCGCTGTGTGGGAGAGT
AATGCACCCAGAGAGGGCATGGAAGCTCGATGCCACTTTTTACCTAGACTTGCCCTGTGC
ATTTCCCCTCTGGATGTTTCTCTATATCCTTTATCATGTCCTTTAAATAAACTGGTAAAC
AGTAAGGAAAGTTTTTCTGAGTTCTGAGACTACTATAGCAACGAGTAGGGGTTTGTGGGA
AACTGTGATTTGTATCTGATACTGGTCAGAAGCACAGGTAACAACCTGGACTTGTGATTG
GCATCTGAAGTGAGGGAGAAGCAGTCTTGTTGGACTGTGCCCTTAACCTGTGGCTCTGAT
GATACTTTAGGTATACAGAGTGTCAGAACTGTGGACACCCAGCTGGTGGCACAGATTTGC
TTGGTGTGGGGGGAAAACCTACATCTGGTGTCATAAATGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved