Canis_familiaris Locus Mono:71:SNORA62
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:71:SNORA62
Canis_familiaris
Mono:71:SNORA62
3
SNORA62
1001..1136
2136
AAGTAGATTGGATCAGAATCACTATTGCCATCAGAAGGGAGCCTGGTGTATCAGAGCTT
TTCATGAAATGTAGACACAGCATCCTGGGAGTAATTGCGTGAAGCATTTGTCCTTATAGT
GGGAAAGTTATCCTAGAGAAGTAAAAATGTATTGATTAAATATATATATTAATTGCTCAC
ACTTCACATAAACTTTAAAGTGATGCCCCACCTTCACATCTTACTTGTCATATTTAAGTC
CAGAAACCTTTTCTTCCTAAATGTAGCATAAACAATGTAGTATTTTTCCCCTCAACTCTA
TAACTTAAATCACTTGGAACACTGAAAATTATTATTGAATGGAATTTCTGTCTTAAATCC
TACTAGGGTTTGTAGGAGGGTGTGTAATACCCTAAATCTAAAGTTATTCAAGTCATAAAA
AATAAACTTTCATCCTGAGTTCTCATATATATAACATCAGAAGTTAATAAGTATCGTCAC
AAATGACCCTGTCCCCTCCATGTTTATTTTTCCGCTTTGCCTTACTCATACATCTTCTCC
TAGTTAGCTGAGTTACCTAAAGTTCTTGTGGCACATTAACTGACTTTGGCTGAAGCTGCT
ACAGTACTCAGGTGAGAGGCTATGTGGCTTAGGCCAACATGGCAGCAGTGGAAGAAAAAT
TGGGAGTTAATCAAGTTCAGGGTATCATTTTGAAGATCGAGATGACTTCATCGCTCATAG
TTTGGTTGTGAAATACAAGGTATCACTGATGGTGACTGAGGGATTCTCAGGTTTGTGGTG
GGGGGAAAGGGTTAGAATAATGGAATTTAATAAAGAGATCTATTACACATTCAAGTATAA
AAGTCAAGCAAGCATTTGATTACTGAAACCTGAGTTCAAGAACACAATCCGTATTTGAGA
TACAAAGTGGGGGATTACAGGTATAGCTCTGAGATTAGATCAAATCGCCCAGGATGTGAG
TCTGAATAGAAAAAGAAAAAGAAAGTTGTGCAGAGAAGCACCAAGTGCTCCAAGATTTAG
TGATTCAAAAGAGAAGCATAAAGTGTATGCAGTATACTACACGAGTGGCAAGTCTTTCAA
ATCACCATGGGTCTCTGGCCTGATAAGTAGAGTTTGACAGTAGTACTTGCTACAAGTTTA
AAAAAAAAAAAAAAAAAAAAAAAGGAGAAGAAACCAGAGAAGTCTGAAAAGGAGCAATCC
ATGAAGTAAGAGGAAAAGTGTGCAGGGTTCTGAAGAGTTGTACTCCAGAAGTCAAGTACA
GAAAGTATTTCAAAAAGGTAAGATAAATCAATGGTGTTAAACATTAGCTCTAGAAGAGCA
CTCTGTGGATTGTCCGTTGGGCTTTGGAGATAGATATCTTATGATATCTTTATACAAGAA
TAATTTCAGTGAAGCAGTAGAAATGAAGCTGATTAGAGTGGGTTGAAGAGAGACTAGGAA
ATGAGTAAACAGAGAGAATGAGTATAAAAAAAGAGACTCAGTATCTGTAGATAGTGGTTT
TGATCCTCACTATAGCATCAAATTATAAATTACAGTGAAAAATAAGTACATATTGTGGCT
ACTGGAAAAACCTCATTCAGATCTTTCCTAAATGATCTGAGTCACAAACAGGCATAAATA
AAGATATTTACTACCCTCTCAGCACTGAAGTCTGTTATAGTATTCTATATAAATCACCCG
AAATGTAATTGAATGTCTACTCCCAAATTGTGTGGTACTATACAATTTAGAGTTGAGAGA
TAGAAATAGAGATAAAATAGATATATATCCGAAAGTGTGAAGAATGGAAAGAGAAGAGCT
GAAGGAACTCCATGTGTGGCAGACACACAGTTTTAGCATTCCACACGGTTGCCCATATCA
CAGTGTTAATTCTTAAAGTGTCTTTCTTGTTTTTCACTTATCTAGATCATTCAGACTCAT
GATGTTTTACTTAATTTATTTGAGAAAGGGAGAAAGAATATTCATGTGAATATTTTAGCA
TTACTAGGAAAAACAAAATGCCAATCTACTCTTTTTTCAAGGGCCTATTTATTGGCATTT
ATTTATACAAGTAGGAAAATAAAAGCAGGCCATGTGTAACAAGTACCACATTTATTGAAT
ATCTCCTGATTTCTATTCTTCTCTTCATAAGCTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved