Canis_familiaris Locus Mono:163:SNORD45
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:163:SNORD45
Canis_familiaris
Mono:163:SNORD45
21
SNORD45
1001..1072
2072
ACCAGCGCTGCACTCGCCTCGTTTCTGTAAGCAAACCCCAAATGCCACTCAGTCTCAGC
TCTAGGAGAGCTGCAGGGAAAAGGAGTCAACATTTGCAGACTATGGGAAATACCACTGAC
GTGGAAAAAGAGGAGAGCCATGGATTTTTACGTTTTTGAGGTTATGTGCCCCTTTGAAAA
TCTGACAGCGGCATCAGACCCTTGCTCCCGTTCATGGTTCGTGCCCCTTGACCCTCTGCA
AAATACATATCCGTATAATGTCCTCTCGTCCACTGAGACCCCCAGAGCGCCGTAGCCTCG
GGTTACAAATTCCAGTGAGTGGGTCCGGTTGGAAGTCGAGCAGAAATAAGCTAGGCAGAG
ATGACATGGGAGCACAAGGTAGACGACGTCTGGTCTAAGGAATACAATGGAGGCACTCTG
TAATTAGGATTTTGTGTTCCTGAAGGTCTTTGCTTTGTAGAACAATGTGGTTGGCACAGG
GCGACCAGTTGCACCAGAGTCAAATAAGGCAGACCTCTGGGCGCCGAGGGGAAGCCGCTC
TGAGTACTTCCCCAAATTGATTGATTGATTTTTAAAAGATTTTATTTATTTATTTGAGAG
AGAGCACAAGAGGGGAGCAAGGGTGGGAGGCAGAGGGAGAGGGAGAAGCAGACTCCCCAC
TGAGCAGGGAGCCCGACGTGGGGCTCGATCCTAGGACCCCAGGATCATGACCCCGAGCCA
AAGGCAAATGCTTCACACACTGAGCCACCAACCCTGGTGATCCATCCACTACAACCCACC
ACGAGGCCAGGATTTTAGTCTGTCTGTGTCCACCACTGGTCCCCAGTGTCTAGCTCAGTG
CTTGACCCATAGTAGATACTCAATAAATACTCATTGAATGGTTGAATCAATTAGTCTGTT
CTGGGTTGCCCCGCTTCACTCTGTCTTCCTCTTCTTCATTTTGTTCTGGATTTAATCAGA
TTTTAGGGGTTTTTATTGTTGTTGTTCAAGATATTTGTCGAGGTCAGCAATGTGATGGCC
TGTGTTAGCTGAATCCAAAGTTGATGTAAATTCTAAAATTACACGAAAACCTTGGGTGGA
AAAAAAAAAAGCAAGATTCATCTTAGCCTTCTACGTCTTGTTGTCTAGACGTAGAATGAC
ACGAGATTGAAGAGCTCCTGCTCTGGGATTCATGAACCCGAGGTTAACCTCTCAAGTCTG
CTGCTTGGGGGTGACAAAAGCCTCAGTGTCTTCAACTGTAAAATGGGGTGTGAGAATTAA
AGGAGGTCATGCAGTTAGAGCACGTGGCACAATTCTTGGCATACACCTACCTGTTGTTTT
CATAAAAGGCAGGCATTTTTATTCTTACCTGGCTCCCCTGCCCTATAGTGTGTTGGTTCC
TTCAGGGTCCTCTTCTCTTTCTGAGCCCACAGTCCTGAACCCCAGAAACTAACTTGCTAA
CTATATAGTGGTCAAGTGCAGCCTCTAAGAAGCCCCAGGAATATTCAATCATGGCTTTAT
TTAAGGATTGGGGATATTACTAATTTCCTCCCTTCCAATTTTTCCATATTTTTAATTTCA
ATTAATAAGCATGTGTCACTTCATCATTTAAAAAGGACCGAATAATGGGACCCCTGGGTG
GCTCAGTGGTTGAGCATCTGCCTTCAGCTCAGGTCGTGATCCCGGGGTCCTGGGATCGAG
TCCTACACTGGGTTCCCCGCAGGGAGCCTGCTTCTCCCTCTGTCTGTGTCTCTGCCTCTC
TCTGTGTGCCTCTCATGAATAAATAAATAAAATCTTTTTAAAAACAAACAAAAATGACCA
AATAAGAAAAAATATTGTAATAAAAATGTGTTTATTCCATTTTGCTAAATTCAGAGGTAG
GAAACAAGCACATTTTATTATGTCTGGTCTGTAGAGTCCGTTCTGGGAAACTGGGAGAGC
TCAATTTGTCCATAATAAAAATGCCTAAACACAGGCACCAAGAAAGGAAGGCTGCACCCC
TGAGTGGGCTCGGATGTGCTGTTCTGTTTGGTAGATGTGGGGTTAGGAATGGGGACTCCT
GGCTGCATCTCCCAGCACCCCCACTACCCAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved