Canis_familiaris Locus Mono:81:SNORA25
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:81:SNORA25
Canis_familiaris
Mono:81:SNORA25
3
SNORA25
1001..1117
2117
CAAACTAAAAATCAATGACTTTTCTTGAACAAAGCAGAGAGCTGAGTTTGCAGAATAAA
TCACCACTCTGAAATCTGGGAGTTGGGTGAATCCAAAGAGTCAGAGCCAAAATGAACTTA
CCTGAAGCAGAAGCCACTATGGCCAGTAAAGGGTGGCAACATTTAAATAACAATTTTGAT
AAACTGCTGGAGGCTGCGTGTGATCCACTTTGAGAATGAAAAACTGCAAGGCAACACTGT
TACGGGGATAAACTCATGGATTTTACCTGCAGAAATCCCATCAGATCCTCCTGGTAAAGC
ATCAAGAAAGATTGCTCACATGGCTCTGACATGGCAAGGGAGAAATGAACCATTTTAAAA
TACACCCAGAGTACTATCCATTAAAAAAGGCATACTGTCCAGGAAAAATGCTTAGTCGGT
GTCCTATTTCACACAGGGAGAGAACTGGTTCCCATCTCCAGGCCCTTCTAGCCATCCGGT
CTCACCCAAGTGGGAAGAGCTAATGAATACCTGTGACAGTCACAGCCAAGGAACACAGGT
CCACTATAACACTGTGACTTAATCATAAGAGTATAGAAAGCTTCCCTGCCTCCATACTTT
ACCATAACACCAACTGGGATCCAGTGTAATAGTAGTATATTACACTTGAAAGAACTTCAA
AACACAAACTTCAAAGGAAGCGTTCTTTGAGAAAGGGGAGAAAAAAACAAAGATATTAGA
GGAATTGGATGTCTCTGGCACCTAGAGCCTCAGCAAACATTCAGACAGACCAACTCCTGG
CCAATTAACATAAAACCTCACACTAAAGGCCTATTTACCTGAGTTCTTATTACTCTATAC
ATCATATCTCACTTTCAAGAAAAAATTAGAAGACACACTAAAAGGCAGTTTGAAGGAAAA
AGCATTAGAACCAGACTCAAATATGATATGGATTTTTGGAATGATCAGATCAGAACTATA
AAACAACTATGATAAATATTTTTTAAAAGGTTCCAATGGCTAGGTCATTTCAAAGAGGGC
TTTGTGGAACTAAAACCAAGGGCTCTTAACTCTGTGACCAAATATTAGAGTTCTCCATAG
GATGTAATAGTGCTATGTTTTCCTGAAGAGATACAAGATTTAGCTGCTTCTATCCAGGAC
TGGTCAAGTAGGAAAGAAGAAATGTCTTTCAAATATACATTTGTCCTCAGGGCTATTTTG
AAGATTATGATTCTGACTTTAGAGGAACTACAGTGATTGGCAGCAGAAGGAAATAAAAAT
TTAATGACTTAAAAAGTTCCAATGGAAAAGGTAGACAAAATACAAGAACTGATGGATAAT
GTATACAAAGAGATGGACACACTAAGAATAATAAAAAGGAAATGCTAGATATCAAAACTA
CTACAACAGAAATGAAGAATGCCATTGATGGGCTCATCAGTAGACTAGACACAGCCTAGG
AAAGAATTTGTAAGCTTTAAGGAAAGAATTTGGAATTTCAGAAATTTCCAAAACTGAAAT
GCAAAGAGAAAAAGAATGAATAAAACAGAACATCAAAAAAACTATGTGACAATTCTGAAT
GGTATATCATACATGTAACTGTACTACCAGAAGGAGAAAAGAGAATGGAACTTAAATATT
TGAAGTAACAATAGCCAAGAAATTTCCATAAATCAATTAAAGACACTAAACCACAGATCT
AGAAATCTCAGAAGACAACAAATAGGACAAATGCCAAAAAAATTACATGTAGGCACACCA
TATATTCAAACTAACACAAAACACTACGAGGGGCACCTTGGTCGCTCAGTCGGTTAGGTG
TCTAACTCTTGATTTTGGTTCAGATCATGATCTCAGGGTCATGAGATCGGCATGGAGCCT
GCTTAAGATTCTCTCTTCCTCTCCCTCTGCTTGCCAACCCTCCCCCACAGCCTCTCACTC
ACACAAGTTCTCGCTCTCTCTTAAAACAAATAAACTGGGATGGGATCCCTTGGTGGCTCA
GCAGTTTAGTGCCTGCCTTCGGCCCAGGGCGTGATCCTGGAGTCCCAGGATCGAATCCCA
TATCGGACTCCTTTAGTGCCTGCCTTTGGCCCAGGGCGTGATCCTGGAGTCCCAGGATCG
AATCCCATATTGGACTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved