Canis_familiaris Locus Mono:97:SNORD14
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:97:SNORD14
Canis_familiaris
Mono:97:SNORD14
6
SNORD14
1001..1091
2091
AACTGACAATGAGGTCTTGATATAAACACTAAAGCAGTTTTAGTTTGGTTTTTCTATAC
ATAACACATTGTTGAAAGTTACCTTAATAAATTTAAAAAACAACAAACACCTGTGGCTTT
AAAAAAAAAACAAACAAACAATCTTCACCACCCACATTGCTAAGACTTTATCAGAACAAG
CCTGGGTGCATTTTAGAACGTCCTTTTTAATTAGCGTTCCGGGCCAGAACCTCTAGCAAA
ATCCATTCTCCATTGATCCGCCAGGAAGCAAGCATGTCCCAGGTGGCAGCTGACTGAGAC
TCTTAAGGGCAAGTCCACAGGTCTCGCCTGTTTATTTCACCTAAATCCTTTAGTTGTCAC
AGGTAATAGTTTTCAAGTACTCTGGGACAGAAAGAATCAAACAGGTTTTGTCCCCAAGTG
AAAGGTCAATGGAATAAGTCAGCTTGGCCAAAGTCTCAAATATTTGCCTGCACCCCAGTG
GTTCTGCCAAATCAAATCAGGTTTATTAGAGGGTCACCTCTAATCAGCACTAGGTTTTAT
CTGCATTTGGAGATGTTTAGGCAGATTTATTTTAATTCCCTCAGAACAAATGAAGCCTGG
GTCTTCAGACTTTAATTGTCACAACTGTCTGCCAGAATGTTTTGTTCCAAGGGGGAAGCT
GAGGGAGCCAGGAGCCAGACTGACATCATCAGCTGTGTATTTAATTAAAACAAGATGAAG
GGCAGGCAGGCTGGAGAGGACAGTGGGTCAGCCTTTCTGTCCCAGTGGCTCCAACACTCA
TGAAAACCTAAGGGGCTAGACTTGGCTCCCTCTTCCCCCTTCCCTTACTCCGTGTCTGAC
AGAAGGACCATCCTTCCTGATGACCAAGAAGTAAAGGCCCCTGTGTGTGCCTCTGGCTTC
TCCATGAGTCCTGAACATCACAGGGAAAGAGAATCAGCAACTATCACCACCTAAAAGCCA
ACAAGCCACAAATCCCTTACAGTAAAATACAAAATAAGCCTTTACAGTAATGAATGGTCC
AAACATCTGACATTTACACCAGAATTTTAGATGTGCTGGCAACTAACTTTCCTTCCTTGG
ATGTCTGAGCGACCCAAGACTTCATGAAATAGCCAAGACCTTCCCTTAATGTGACAGTAA
ACATCTGCTGCTAGTATCTTAACATCTGATTGCATCAGGCTTTGAAGGGCCCTTTATTTG
AAGTACCTGTGGTTATAAACCCAATCCCTTTCAAAACAATAAAAAATAAAAGCCTGACGC
TGGGCTTGTGATCCAACATCAAATCCAGGTTTTCAAGCAAGTTCTCCCATTTGAAAACAG
AATAAAGTTAACTCAATTATCTGGTATTCTTTCCTTGGTCAGTCCCAGAGGACAGAGGCT
ATGTCTCATTCACCCTTTGACCCTTGCCACTTTCCTGTGCTACACTGGGCAATTAAATCA
AACAACAGGATATACTAATTGACCAACTGGTCCTATGCCCCTCCTTTTTTTCCCCTAAGG
GAACAAGAAAATTTAATGATCTGAAAGGCAGAAAAATGGTGAGCTAAACATCTTTTTAAA
TGGGACCAAAATGGGACGCCTGGGTGGGTTAGTGGTTGGGTGGCTGCCTTCAGCTCTGGG
ATCTGGGATTGTGTCCGGCATCAGGTTCCTGCGAAGAGCCTGCTTCTCCTTCTGCCTGTG
TCTCTGCCTCTGTGTCTCTCATGAATAAATAAATCTTTTTATTTTTTTAAATAAAAAATA
AATAAATGGGAGCAAAATTAACAATCTGGATAAAAACCAAGAAACTGGAGGATGGGTGTT
TCTGTTTGTGTCATCAGGACTTGTCCCCAACAGACTGTCAACCACACTATTCAAGGAGTG
TGAGGAACCTGAGCCTTTGTGGGAACCCCAGTCGAGAACTCATTTCACCCTGGCAGCAAG
CTCGGATTTCCCAGGAGGCCTTTCCAAGCAATCAGCGGTCAGCTGTGCACAGACATCTAA
TGGCTCTGGAGCCAACTTGTGTCAGTTCTGTGGTCACCACACAGTGGGGAAGGGGCAGAG
GGGCCTACTGTCAGGAAGCCCAAAGAAAATTAAACAAATCCTGTCTGCCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved