Canis_familiaris Locus Poly:15:SNORD48
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:15:SNORD48
Canis_familiaris
Poly:15:SNORD48
12
SNORD48, SNORD52
1001..1063, 1879..1946
2946
AAAAGGGGGGGGGGGGTAACGCCTGGGTGGCTCAGCGGTTTAGCGCCTGCCTTTGGTCC
AGGGCGTGATCCTGGAATCCTGGGGTCAAGTCTCACATCGGGCTCCCAGCCTGGATCCTG
CTTCTCCCCTCGCCCGTGTCTCTGCCTCTCATGAATAAATAACGTCTTAAAAAAAAAAAA
AAAAAAGGTTAACGTGCCTGACAGTTGTGCAGGCTGGATTGGGTAGCGAATTCAGATTCA
GCTGGCTAGATGGAGCCGGTGACCCTCTCTCGGAAGGACCGGAACCCCGAGGTGCACCGG
TGAGGACAAGGGAGAGGGCCCTGGGGCCGACTCTCAGGGGACCCGCCCGCCTGGGGAAGC
CCCTGCGGAGGAGCGCTCAGCTGCGCATGCGTCTGGCAGGGCCAGGGACGCACCTGACAC
CGCCGGTCGAGAGACAGTCATCTCTTTTTTGTTTTTCAAAATTAACAAAATACGTGCGAA
TATTTGCCCGGAAGAGTGTGAGACATTCACGGCTGGCCTCTCTTTCACTTGGCCTGTTCT
CTTTCGGACGAAGAGGACGGTGCGGTGGTCGAGCCAGGCACTGCGAAGACAGCCCTACAT
GTCAGGCCCCCAGCACATGCCGCTATAAATAGGCGGGGCCGCGAAGGCTCGCTCCCTTTG
TGCGGTGGTCGGTCCGGCTGCTCTCGTGCCGTGGTGCTGTGGCGGCTCGATGCGGCGCCC
ACTCTCCTACACCGGGGCCCTGCTGGGGAGGGGGCGGCAGCCTCGGGTTGAGCAGGATGA
GCTGCCCTTACAGACTAGAGTTTCTGATGTGCCCGTGACGGCGCTTTTGGGAGCTGACCC
ATCCCAGGGCGGAGGGGGGCGTTAGGCTGCCGTCGCCCACCCCCCGCTGACCTTTGGTGT
CCTCCCAGACCCCTGGTCCTCGCAGGCCGATCCGCAGCGCTACCAGGGTGAGTGGGTTGT
GCGAGATGGGGTGGCCGGCCGAGTCCCTGGGGGAGGACGGGAGTGATGATGAACCCCGGT
GACTCTGAGTGTCTCGCTGACGCCATCACCGCAGCGCGCTGACCAACCCCGGCCGCTGGG
CTGGGGAAAAAGCGGACGGCCCGGAAACCTTTACTAGTGACGAATCCCTGTTTGGTTCCC
CATTAGGTGCTTGAAGATTTCCGCCGCTGTTACCCTTGGTTCAAGGTATGTATTAGATGT
GAGGTCTTTCTCAGTGCTGCTCACCATCTCGTCCCCAAAGCTGTTTTTTTTTTTTTTTTT
TTTTAAGATTTATTTATTTATTTATCATAGAGAGAGAGAGAGAGGCAGAGACACAGGAGG
AGGGAGAAGCAGGCTCCATGCTGGGAGCCCGACGTGGGACTCGATCCTGGGACTCCAGGA
TCAGCCCTGGGCCAAAGGCAGGCGCTAAACCGCTGAGCCACCCAGGGATCCCCCCCAAAG
CTGTTTTTATTCAGTCAGTATGGAGTTTGCTTTCTCTTGAGCACGCACAGCAATGCAAGT
ATTGTAACCCGTGATTTTTTTCCAAGGACTATTTTTGGCTTACATTTCTTTTGTAATTGT
TTGGAAAAGACCTTTTTGACTTTACATGTTTTTGTCTAAGCCTAGTTAAACCTGCTTTAT
TTTTTGTGTACGTATATTTTTTTATTGGGGTTCGATTTGCCAACATATTCTGTATATTTC
TATATGCTTAGCTTTTCTGGTGGAGGTATTTTTTGCAGTTCCGAGGTCCGTGTCGCGAAG
TCCCTCCTCCCCCCCTTTAATTCTCCCCACTTCTCTCGTCCGTGCTCTTCGTTTGCTACA
TCCTTGCTACTGATGCAATTGTTTTTAGTGCATTACACCCTTTCAGAATGGCCTCCCCTG
ATCCAGCCCTCCTTAAAATGGGAATGATGATTTCTCAGACTAGAGTCTCTGACACTGGTC
TTGATGTCAAAAATTACGTTCTGACTCATTTGGAGAACTGGATAGTGAGTCTGAGAAGGG
CCCAACAGGGGGGCCTTGACATTGCTTGTACTTACCATTGGCTGTCTGTCCTGTTTTCAT
CTTTCTAGCTTGATTATTCTGGAAGCCTACCTGGGGCGGTGCCCTTTCAAAGGTTAGGTA
CTAATCAGATACTGAAGGGCTGAAGTTTGTAATTCATCCTCTTGGATCAGTGCTATTGAA
ATGACTGTACCCTTGGAATGGCTCCTGCCACTCGAACCTGCAGTGCAGTCTGTGAAGAGT
CACGTCCTTTTTCCTTGGCTGCTATGGTGAGTGCCAGTTTTTCTGCCAGCCCCAGAGTGG
TAATGATAACCATCTTGGAACATGAGTATTTCTCTGAGGATCTTTGAAACCACTGATTGA
GGACTCCCCTAACTGCCCAGGTTCATGTTTTAATTCCAGTTGGCTACGTGGTTCTAATAC
ATGTTCTTTTATGAAATTTCAGGGTTTTGTTCATGCAGAGGATGCCTCCTATCTGGTTGG
TGTTGGGCAGATCCTAGGAACTTCCATCTAATTTCCCTGCATTAATCTATGCAAGCAGCT
GTCAACTTACTGGAGGAAAGAAACTGCCCAGAAATTTTGAGATGCTTAAATACTTTTAGA
CCAATTAGATTTATTTAATATGAATACTTGTTTTTATTAAAAGGATTCCAATAAAATACT
TTAAAATAAGCTTGGTCTTCGTAAAAATAAGGTGGGACAAAAAGATTTGCGGAAGTAAAA
GGGAACTTCTTTGGAATGAGCATCACAGTTGACATCTAGCTATATACCTCTTTGCAGCTT
TATAGAAAAAACTAAAATGAGGTTGACCCTAAAATTAAGAATTTTAGGTGGTGTACCACA
GGATTTTAATGAACTAGATGTTAAGTAATGAAAATTTTTAAGGTGTTGAAATACTAACAC
TGGGGGTGGGGACACCTGGGTGGCTCAGTGGTTGAGTGTGTGCCTTCACCTCCAGGTGTG
ATCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved