Canis_familiaris Locus Mono:170:SNORA25
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:170:SNORA25
Canis_familiaris
Mono:170:SNORA25
36
SNORA25
1001..1127
2127
CAAACCTAGCGCTTTGCATCAGAGGCCCTTGGTTTGGTGGAAGGAAGGCTGCTCTCTAC
CTCTTTAATCTTCTTCACCAGTCAGTCCAATTCTTATCCATAATCTGGGAGCCCACATCT
AGAGTTTTCCTAAATGTTTCCCCTAACTTTCTATGATTCTAGCCCTGAGCCTTCTAGCAA
GGTGACCTGATTACCTATCTCTCCACTGGGTGTTAGATTAGCCTCCCTTAGGCTTTGCCC
TTAACTCTGTTCCCTGCTTTTCAGCAATCAGAATTCCCTGGAGTGACCCCCTGCTGACTT
GGCCATCTTCTCTGTCGATAGAATCCTGCCTCCACTGACGCCATGGATGACTTTTTCTAC
TCCTACGAATGACCCCAACACCACTGGGGAGGTAAGCAGGATTCCACATTGCCTTTTCCC
TCCAACTGTCTGTGGAGTATCAGACATTCCTCAGGGAAGCCACAAAGAGTTGACTGTCTT
CCACTCTGAAGTAGTAAAGATTCCTAGGGGAGGGAATCTGCAGCCTGCCCTCCAAACCAA
ATTGCTGAAGACCCAATGTACTTGCTCACTTACCTGCACGCACCCCAGGGGCCGATCTAA
AACAGGCCCAACAGAGCTAGCAGGTAGCATGAAGCTAGATTCTCCAACCTTGGGTCATTG
TATTTTTACACCCATCATGGAAGTAACACATGCCCCCAAAATAGCAGCTTCACTACACCA
CAGTATCAGGAGCTATAATTTATCTCTAAATATAGATTTGAAATACAAGAAACAACGCTT
CCTATTATGTGCCCTTTTGAAGGGCCAGATTTGTTTCTGCAGAAAATGAGACCTGGAAGA
AATCATAAGAAAGTACTAGGGTATCAACCAGAACTACCCACGAAAGTGGAGTTCATTCCA
CAGCACTTAGAGATGTGACTGCCAAGAGGATTTCTGGTTCTCAAAATCTGCCTATGTCAC
GCAGAGGTGAGGGGTCTTTCCGCCCCAGTTTAAACAAATGTAGATCATCCTACAGAGGGC
TTTGGGGGCTGTGAAACCAGGAGCTCTTAACTCCATGACTGAAGATTGAAGTTCTCCATT
GGATGCCACGGTCACTCAATAGTCCTAAGTTATTGCGAAGAAATATGCAATGTAGCCACT
CCTAATAATCATAATGGTTCATAATAGGCCACTCATGATAACCCATGGCTGGTGATCTGG
GAAAGTAAACAGATGTCTCAAAGTTAAAATATTATCACTCTTGGGGCACCTGGGTGTCTT
AGTCGGTTAAGCATCAGCCCTCCGCTCAGGTCATGATCCCAGGGTCCTAGGATCGAGCCC
CTCTTTGGCCTTCCTGCTCAACAATGAGGCTGCTTCCCATTGCTCCTCCCCCTGTTTGCT
CTCTCTCTCTCTCAAATAAACAAATAAAATCTTTAAAAAAAAAAAAAGAATAGTATCAGT
CTTACATCCCATTATACATACCAACAGTAGATACGTAGAATATGGATTCGTCACCATAGC
TAGATAATTGGGATTCACATCAGAACCTAAACATTAAGTAACAGTTTCTTATCCTTCTCT
CTAAGTCATTTCTCAGACCTGGTGGCAAAGACAAAAATTATCCAGTGTGGATCACATTTC
CCTGCTGGAGGAGGTCACTGAGGGAACACAACCCCTGGCTAATACTTGAGCTGGCTCCGG
GTAATCAGAGGAGTGGCTCCTATCCCCGGCCCCCACCCGCACCCTTGGAATATGTGTGGC
ACCCACCATTCCCACACTAGGAGCACTACCAGGACACAGCCTTGAGAGTTCGGTGTCATG
GGGACCGTCTGGACTGTGTACGTGACTGAACCCCACTAAAGCCTCTTTATAGATTACGAT
TCTGCAAGGTGGGGGGAGGGGGCAGAGATCTCACTTTAGCACAGCCCAAGACAGGCCTTG
TGGGCAGCCCGCTGACTTAGTACAAGCGCCACCCACCCACCTGGAGTGGCCTGGCTCTTT
CTTCCTTCTTCCCTTGCCCTCCACGTGCAGGGGCCAGTGCTGGAGTCACCGGGGGAATTC
CTGAGCTTGGACACCAAAACCCCACTCTACCCACCAAACCAGCCTCCCCTGCTCCTGGTT
CTAACGATGATTAAAGTCCAGTTGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved