Canis_familiaris Locus Mono:133:SNORD89
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:133:SNORD89
Canis_familiaris
Mono:133:SNORD89
10
SNORD89
1001..1115
2115
TTACCTCTTTTTTTTTTTTTTTTTCATTTACCTGAAGTAAACTCTGGCCAGATTCAATT
TGAGGAGCTACTGAAACTTTCTTTGAGCTCTCATTTAACAGCCTCAAAGTAGGTTTCCAT
AATAGCCATTATCATTGAATTCTGCCCTCTGTGGTTTATTGAGAATGGAAAAGTATGTCT
TTGATTCTGTACCATGTAAGTTTTTGCTCTTTGTATTTTAAGATACATACTTGGGAGAAA
TGCTTTAAAAATTAGCAGTTCTTTCTGGTATCCAATGAAGTAGACTTTCAAAAAGAATAC
TGTAACAGATCAAACACACTGTTTTTTATACTCAAGAAGTATAATGTCTTAATTAGCTAT
CAGACCTAGCTTTCCTTCATTCAAAAATTTTAACACTAAACTATACATATAAGAGATTGG
AAGGATTGTAGTGGTCTGGTCCCAATCTAGAAATAGTCCCATCTCTCTCCTTCAATAGCA
GAGAAAGGAATTATCAAGAGAAAATAGAAAACTGCAGCACTTTAAAAGTTTCCTTTGTTA
GGCTTTTTTTAGATAGAAATAAATATGATAGAGAAGGGTCAAATATTAGCAGAATTTTTG
CTGAGACATAAAATTGATGAAATGCTACTTGGAATATGGGCAATGTAATGAAGGAGGAGT
AAACCAGAGTGGTTTGATTAAGGTTAGTCATACTATTTATGGCAGTAATAATTTTCCTTC
CACAAGTGTCCATTTGTTTACAAATAGTGTAGAAACAATATACATTTTTTTACCTTTCAA
AGTCACAGTCAGCGTGTAAAAGACGCAGTTTGGCCTTGAATGTGAAGCACTCTGTCATCT
GCTGCCATTGGAGCTGCTTCTGGGTTTCCCACCGGAAAACCACAAAGGCTGGGAGGAGGC
ACAAAAACACGGCACCTTGGGCAGGTAAACCTCCTTGCTTGCTGATGTTTTGGGGATCTT
CAATATATAAAGCCTTTCCTGAGAGATTGTTCACTGCAGTCACTGAGGAGTGATGACAAT
AAAAGGCCGAATTGCAGTGTGCCCATTAGCAGTTTGCTCTCTGTGGGGTGCACGATGACA
AAATCTCCGGAAGCGAACCACTGGTCTGACCTCAGTAACATCAGAATTGAAGTTTGCACT
TGGGCAGTCTTTCCAAGAGGAGTCCTCCCAAAAAGGGCTCAAATATTTTTTAACGAAAAA
AAAAAAAAAAAAAAAAAACTGGCGAACCTGAGACATCTGGCCTTAACTGAGTAGTAAATA
CCTTTCTACATACTTTACGGTATACTTGCTGAGTCCAGGACTGCCAGAACCATAAAATAA
TAGACTTTGAAGAACAGGTGTGTTCCCACTTGGATGAAATACCTAGGGTAACCAAATTCC
CCAAGAGGATAGCTTAATTGGCAAATCTCTTCTTTTGAGAACATTAAAATTTATTTGCTC
AGTGAAGGCTGAGATTAAATCAGTATGTGTATGCTACTAACTAGAATTTGAAGTAATTAT
ATGTTTGGTTAAAAGCAGTTTCTTTGAGCTCAGCACACTTTGTGATTTACAAAGCACAGG
ATGCTGGCCTGAGCCAGTGAATCTTCTGTATAACCTGTGCTGTTTCTGTGATGCAACAAC
TAATTAGAAAAGCCACCTACACCTTTCCCAGTTAATTTCGTTTTTGAAGTTTTAAAAAGA
CAAGCATTTCACTTTAAAAAATGCTAAGGTGTGGGATTCCTGGGTGGCGCAGCGGTTTGG
CACCTGCCTTTGGCCCAGGGCACGATCCTGGAGACCCGGGATCGAATCCCACGTTGGGCT
CCCAGTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCTCTG
TGTGACTATCATAAATAAATAAAAATTTAAAAAATAAAAAATGCTAAGGTGTAATTCTAG
TTATAAAAGTGAAATTTCTACAATATCATCACTAGCCATGCATCTAGAGATTGACCTTTA
TTCTAAGAGTAAGTATAAAATAAGTTGTAAATTGAAGAAGGTATGTGGATCACATTAAGA
ATAAAAAAGTCCGGGCAGCCCCAGTGGCTCAGCGGTTTAGCGCTGCCTTCAGTCCAGGGC
CTGATCCTGGAGACCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved