Canis_familiaris Locus Mono:139:SNORD93
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:139:SNORD93
Canis_familiaris
Mono:139:SNORD93
14
SNORD93
1001..1072
2072
GCCTCTCTCTCTCTCTCTCTCTCTCTCTCCCATAAATAAACAAACAAACAAATAAATAA
AATCTTAAAAAAAAAAAAAAAAGGAAAAAAAAGTAGCGTTGCAAGCTGTGCTGTAGGCAC
CCCTTTAGCAGCCGTGTGTTTGAGCCCAAAGCCCAGGGCCAATTTTCCCTGCTTGGAGTC
CCTCAATCTGGTGACTCCCACTATGACACCGGGAAGCACGACGGTCAGGCTGTTTTACAA
CTGCTTTATGTGTGGGGGATCCCTCTGGGGCCCAACTGTTTCAACATTTCCCTCTGAGAC
CGAAACATGGGCGGAGAGAGCCAGACAGCATGACAAGGAAGCCGCAGCTTGAGCCAGAGT
CTATTTAAGGATTGTGGAAACTGAACAGGAGCGGGGACTGTTCTCAACTTGCTAGCTCTG
CTCTGGGTAAACAAGTTCCAGGCTTCCTTTGGTTTTTAAATCTGTTTAGAGTTTGTGACA
GTGTTTCCTAGGTACAAACTGTTGCCAATAGTAGTCACTTTTTTTCTAAAATTGCTACTA
TTCCAAAAGAAAAAAAAATGCTACTATTCCATGCTAACTTAACAAAGAGATCAAGTTGGA
AAGATCCTGGCTGGGGACATTATATTCTATGGAATCCCAGAGGATAGGAGCTTAATTCAC
TGCTCATTTTACTCCCGGCTGAAAGTTACCAAGGAGATTTCCCCAGTGAGGACGTTTTGG
AGAATGTAGCCTTTTTACAGGAACTCTATTCACAGGGAGCTTTTTATTCATCGGGGGTAG
CTACTAGATAATTACAATAAAAGACACTACAAAAAAAAAAAAAAAAAAAAGACACTCTAC
AAAACAAACAAAAACCCAAACCATAAAAAGCGACATAATTCTTACCGTTGTTCTTCTCAC
CTTCCTCAGGCTCAGTCCAGTTCAAGATGCTGATGAAGTTCAGGTATGGACCAAATGGAG
GGAATTTTGCCTTGAATTATTAAAGAGCTGAATGGAATTCTTGGCCGAGGATGAGAAATC
TAATCTGATTGGATATGCTTCTCTGATGGCGTTGAAGGATTTACCTGAGGCCAATGTGAT
AGGAATTGATTACTTGGTCAGTCCCTCCTCCCTTTAGGAAGTATGTTTTAAATAGGAAGG
AGGAAAGCCTCTAGAAAACAGGTAATACTTAATTATGCCAAGAAAAGGTTATTTTTTAAA
TGGATTTTTAAGTAATTGACACTTAATCTTTCGAAGGATCTTTTCCAATGGTGGCCATTT
TGCATTGGAGTCTTCCAGAAGGCTGAGGTGAACTGTTAGCTTTGGTAAGATAGGATTTGG
TTAAACATTCACCTTTATGTCAGAATGTTGCTAAATCTGAGCTGTGAGCCCTGAGTTGAC
AATACATAGTATGTTAGGGAATTCTGTTTACTTAACTTGCATCGCTTTTATAAACATGGT
CTAGAAACTTGTTTATTTTCTTAACAGCACATCTTATTCGGTACTTGCTGATCTAACCCC
CTGCTGTGTTACTTCTTTTACAGGGCTGGTGCTTGAAAGACAATTGGGGTGCTTGAAAGA
AGCTTTTCAAGTAGAAAAAGTGTATTTGAACATGTAATTGATACATAGAAGCTTTTGCTT
TCCTTGTCCCTCTTGTGGTAGTAGCAGGGGTGAATTTTGTGATGACAATTATCTCTAAAA
ACCTATCCCTACCTGCTCCCATAGAGAATTTTGTAGAATATAGTTTATTATTTAATGTAG
TCTTTCTACCAACCAACCAGCCCCAGCCGGAAGCTTGGCATAGGAACCAGACAAGCTATT
CTACAACTGAAATCTTATTCTTTTGATTTGTCCTGAAGATATGTTTCAAAGTATCCTTTT
AAAAATTTGGTTTTATATGCTTACAGATTTTTCCATAATAGATCATTTTAATGATTAAAT
GTGATCCTTTTGACAGGGGACAGATCAATGGATTCTCAAAGATTAGCAAGGGGTTGGTTA
CAAAGGGGCATGAGGGAGCTTTGAGGAAATGTTCCATATCTTGTCTATGGTAGTGATGGC
ATTTGTCAAATTTGGGGGTGAGTTTTGCCACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved