Canis_familiaris Locus Mono:35:SNORD12
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:35:SNORD12
Canis_familiaris
Mono:35:SNORD12
19
SNORD12
1001..1094
2094
TAAAGTGAATATCTAAAAGCAAATCAAATGAGTTTTTTTGGTTTCTCAGTGCATATAGA
AGTTGTTTATACTATAGTCTCTTAAGTATGCAATGCCATAATTTTTTCTTTAAGATTTTA
TTTATTTACTCATGAGAGGCACAGAAAGAGAGAGGCAGAGACACAGGCAGAAGGAGAAGC
AGGCTCCATACAGGGAACCTGACCTGGGACTCAATCCCAGGACTCCAGGGCTGAAGGCGG
CGCTAAACCTCTGAGCCATCTGGGCGTCCCAGCATTATTTTCTTTTAAAAAAAAAAATGT
TCATCCCTTAATTTAAAAGTACATCCTTGCTAGGGCCTCTGGGTGGCGCAGTTGGTTAAG
CATCCAACTCTTGGTTTCAGCTCAGGTCATGATCTCCGGGTCATCAGATCAAGCCCTGCA
TCAGGCTGAGCTTAGCGAGGAGTCTGCTAAAGTTTTTCTCTCCCTCTGCCCCTCCCCATG
CTCTTTCTCTCCCTCTCTCTCTCTCTCTCTTTCTCTAAGATAAATAAATAAATCTTTAAA
AATAATAATAAATAAAAGCACTTTGTTGCTAATGAATGCTAACCATTATCAGCCAGTCAT
AATCTTGTTGCTGATAGAGGGTCTTGTCCCAATGTTGAGAGCTGCTGACTGATCACAGTG
GTAATTGCTAAAAGTTGGGGGTGACTGTGGCAATTTCCTAAAATAAGACCACAATGAAGT
TTGCTACATCAATTGACTCCTTCGTGAATGATTTCTCTGTAGCATGTGACACTGGTAGCA
TTTTATCCACAATTGAACCTCTTTCGAAATTGAAATCTTCTGGAACCCTGCCATTGCTTT
ATCAACAAATTAATGTAATATTTTAAATCCTTTGTTGTCATTTCAACAAACTTCACAGCA
TCTTCACTGGGCATATTCCATCTCAAGAAACCATTTTCTTTGCTCATCCATAAGAAGGAA
CTCCTTATCCATTAAATTTTTATCATAAGGTAGAAGCAATAACAAACACAGCTGATAACA
TAACTTTTTTCCCCATTAGATTAACCTTATTGATCTAGCTGAACCATTAGCCAGTGTTTT
TTCTGATGCATTGGAAAGAAAGGGGGAAAAAAAAAAGGCAGCAATTCAGCCACCTCCAGT
TTCCACTTCTAATTCTAGTTCTCTTACCATTTCCTTTAATGAAGTTTGAGTCTTTCAAAG
TCATCCATGAGGGCTGGGATCAACTTCTTCCAAACTCTTGTTCATCATATTTTGACCCCT
CCCATGAATCATGAATGTTCTTAATGGCATCTGGAATGGTGAATCCTTTTTAGAAGGTTT
TCAATTGTCTTTGCCCAGATCCATCAGAGGAATCACTAAATATAGCAGCTGTAGCCTTAT
GAAAGGTATTTCTTAAATAATAAGACTTGAAAGTCAAAATTACCCATTGATCCATGGGCT
ATGGAATGGATGTTCTGGTAGCAGACAAAAACATTCATCTCATTGCACATCTCCATCAGA
GCTCTTGGGTGACAAGCAGCATTGTCAATGAGCAGTAACATTTTTAAAGGAATCTCTTAT
TCTGAACAGTTGGTCTCAATAGTGGGCTTAAAATAGTAAGCCATGTTGAAAATAGATGTG
CTCTCATCCAGGCTTTGTTGTTTATGGACCACAGACAGAGGTTGAGCATAATTTGTAAGG
GTTCTAGGATGGAGCCTATCCTAGTAGCTGCATCACCCAATGCTTTAACTTTAAGTCACC
AGTTACATTTGCCCCTACCAAGAGAGTCAGCCTGTCCTTTGAAGCTTTGGGGCCAGGCAT
TGACTTCTCCCTAGCTCTGAAATTCCTAGAGGTGTCTTCTTTCAATAGAAGACTATTTTG
TCTACATTGAAAATCTGTTTAGTGTTGTCAACTTCAGTAGTTATCTTAGCTCAATGTTTT
ATATAACTTGCTGCAGCTTCTACGTCAGTACTTGCTGCTTCACCTTGCTCTTTTATGTTA
AAGAGATGGCCTCTTTCCTTACACCTCGTGAATCAACCTCTGCTTGCTCCCAACTTTTCT
TCTGTAGCATCCTTACCTCTCTAAGAATTGAAGAGTCCTAGAGCCTTGCCCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved