Canis_familiaris Locus Mono:90:SNORD56
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:90:SNORD56
Canis_familiaris
Mono:90:SNORD56
37
SNORD56
1001..1071
2071
GAGCAACGAGCAATCAGGTCTGTAGGTATCCCCAGCTTCCTTGAGGCCTCTGGAGGTCA
GGCGTCAGTCCCTCTTAAATCTTAGCTCTGCAGCTTTTGTGGTCGCAGCTGTTGGACTTT
AAGCCTTTCTTTTTCTGGATGGGGTCCAGTGTGAGGTGTCAGGTGAATAAAAACTTAAAG
GCTGAACAGACAGATAATTTTGAAATATAATGGCTACCATGGAGAACTTTCAACCTCAAT
AAGCTTATCCATGTGTGAGGTACTCTAGACAAGCAAAGCCAAGCACTTATAAAGGGTAGA
AGGAAAACTGTTTTTCATCCTCTGTGGTTTCTGGTGACTACGATGAGACCTCCTGGAATC
CACCCCCTCACCTCCATCCACCCCCCCACCCCCGCTGCCTACTTGCCCAGAATCTATGGA
TAGGATCTGGGGAAATGAGCAGAAGCTAGCAAAAGACAACAGTTCTCCCCAAAATCAGCT
CTCTCCGATGTCTCTCTGTGGTGTCTGGTTGAGAAAGAAAGGTAAAGTTTCACATTGTCC
TTTCCAAATTCAGACTGACAGACAAAATTATATCTTTGAACTGTGTCTTTTTAATCTGCT
TTCAAGTACTCACTGGTTGTTGATCTTTCTTCCCGGGACGGCTTATGCCTTCTTGTTACC
TTGTTTTGTATCTTGAACCTGGCTTGGGCAACCACTAGGTTAGAGGCTCTAAAAATATGG
TTGGACAGAAATGCAGGTTCTATCCCATCTGACTGCTGCCAGCCTGGACAATTCTCTTGG
TTATCTTTGGGAGTGGTTCTAGAGTTTGGGTGGGGAGTATTTTTTGTGCCCTTTCTGGGG
ACCCTCTTGCATCCATGAGGCTGTTCAATATTGCTAGGAATATTTACTCTTTGTCCTTGC
TAAAACCTAGCAAGATCTATGAAACGATTTAAAGTAGCTCTATGGCCAGAGGATGGCCAT
ATTCAGAGCCTGCTAGACTTTTAAAAATTCCTTTCTTTTCTCTGCAATGATGGCAGTATT
TTTCGTCAACAGCAGTTCACATGGTGAGGGATGATACTTTGGGTCTGAGTGAAGCTGAGG
AGGAAAAAAAAAAAAAGGTCTTTCTCCCCTCAGCTAAGATGAAACCGTACCTAGAGACAA
AATTAAAGCCTCTGTGGAAGGATTTACTAAATTCCAAAGACACACAGCTCTAAATCTCGA
ACATAGGAATCTTTTGATTTCCATCTTAGTTGAAAATCTCCCTGATAATAAAGAAGCAAA
TTGAAGATTGTGTAGTTGGATGGGTGGGTCAGCCTGTTTATCATTATAAGGCTGCAACCC
AATTCTTTGAGAAATTAAACACTGTACTTGTCTTATAAATTAAATGTACAAGAACAGAAA
CTCAGCCCTAGAAACAATTCAAAGCTCATCTATTCTTGTTACCAATCCCCAAACCTCCCC
TATTCATCTAAGGCTGCAGATATTGTAAAATATCTGTATTTAGGAAACAAAAATCCTCCT
TGGTGGAACTTACATTCTTTTTCTGTGCCTTTTGAGATGTAAATATCCTACTTGGTCTTC
TCTAAGAATGAAGACCATTCTCATGAAAAGAAAGGAAAAAAAAAAACCCAAAATGGAAAA
GATATTTTGAAAACTAGGCACATGAAAAATCTTAAAAGTCTCCTTCACAAATACGAGTTA
AAAGCTTTAGCCTGAACCAGTAACCTTAGCTTTATCAAGTGTACGCTCAAATAGAGAAAC
TAACCCAAATGTTTTTGCAGTTACATGATCTAGGATAATCGTCAACAAAGTATCCATGTC
TTCAGAATTATCAGCATTAACTGTAATACTTCTGTTTTACCAGGTTTACTAAGTCAGATA
AACTCCTCTCTCTATCTCTGTTACAGAATTTGTCAGCAAGAAATTTTCATGAGTAATCTA
AACATAATTGTCAGATATAGCATAAAATTTTCCAAAATCTTTTTGGTATCTAGAAACCTT
GAAATTACCCTAAAACAAATTAAATGATGGATATTCATTAAATATCTAGATCATTTCCAA
ATAAAATACCAAAACGAATTACTAAACATAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved