Canis_familiaris Locus mono: SCARNA9
snOPY snoRNA Orthological Gene Database
Canis_familiaris mono: SCARNA9
Canis_familiaris
mono: SCARNA9
X
SCARNA9
974..1309
2309
CAGACGTGTCTTGACACTATGAGAACACATACTTATTTTGGGGACTAAAGAAGACTTCA
CCTTCAAGGTATACATTAGACCTGAGGAAAGCACTGGAGTCAATCAAGTGAATGTATATG
GTGAGGGTGGACAGTGATCTGGGCAGAAGGAATACTCCTTGATATAATAAAAAAAAAACA
GTTTTGCTGGATGGTAAAGTATAATATGGCAAATGGATGGTGGCGGGGGGTGTGAGGTGA
GTGAGGACTAATGGTTGATGGTTTGACAAACCAGCTAAGGATCTGGGACTTTATCCTTTG
AGTAATGTGGAGTGAGCCACTGGTACTTTTGAAGCATCTGTTTTTCACCATGTGGAGAAT
GGTTTTGAGGCAGGTGAAGAGGCAGCAGAAAGATGCCCCAGTCTTAACACATAGGAGCCT
GTTTCTTCAGGCCTGGAGTTGTGTAAATTATATCTTAGTTATTTCTTTGTTTCAGAAATA
CAGAAGAAATCAGTATAGTCCTGAAAGAGTCTTAGATCTTTTTCACTCATTTTGTGTTCT
AGAATGGAAATGCTTTCTTTTCAACAAAGCAAAAATCAGTAGTTTGTGAGGTCTTTTTCT
AGCCTATGGACTAGAGGGAGGTCACTATTTGCTCTTTTATAATCAGCTTCAAGGCAGCAA
GAGACAGAAGTCATAGCTATATAGAGGACAAAGCGGAACTTCTAAATGGATTTAGTTTAA
CTATTTAGATTTATTTTATTCATTTATGATTTTATTTATGATTTTATTTATTTATTTATT
CATGAGAGACACAGAAAGAGAGAGGGAGAGAGAGGCAGAGACATAGGCAGAGGGAGAAGC
AGGCTTCCTGTGGGGAGCCTGATGTGGGCCTCAATTCCAGGACCCCGGGATCACTGCCTG
AGCCAAAGACAGATTCTCAACCACTGAGTCACGAGGCATCTCTAGTTTAACCTTTCAGAT
TTAAGATGCTTAATTCTCTGAGATCTGTTCTTACTGAAGTACATCAATGATGAAAATAGC
CAAATCTGAGCATCAGAAGATCTGCCTGTCTACCTGCTGCATGATCTTCATAGTTCTGGG
AAGCAAAAGTACTTTAAAACAATAAGGGCTTATATCTGGGATTATGAGTGCGTGAGTGTA
TGCATGCATGCTTATAAAAGTGACAGTGGATAACTGAGGACTTGTTGATGGATGAATGAG
ATGGGAGGGTATGTGTGTGTGTAACAGGCTAATCAGTTCTGAGCAGTGATGGAAAGGTCT
CACCATGGACCTTTATAACTATGACGATTTCTACACTTGAACTGAACTCAGAATAAAATA
AAATAAACTATTTAAGATCATTTTCAATACGATTTTCACAATATCTTATGTAATCCCTGC
TGCAAACCTGTAAACTCAGCCTGAATTATCTGCAAACACTGACTCACCAGAGCATAAAGT
TGTCAGAAACTCCAACAGCTATTTAAAGCCTGTGTGGAAGCAAGTGAGCATTACTATCAA
TATTCAGAGACACCACAACCTTCCATAACTTGTACTTCAATCCAGATTTGAATCTCTAGG
AAAGAACCTTATTTTTGTACTTTTGTCCTTTCCCTGTTACTTTGTTGACCTGTTTGATCT
CTTATCCCAGTTCATGCCTACCAACATATATATTAGACAAGAAAATTCAGGTTCTACTCA
GGCTCCATGGAGCTCAAGCACCATAGGGAGCACGTAAGTCAAGGCGGTGTTAGCAACTCT
ATGTTCCATACAAATGGGAAATATGGGTAAATATTTCTTATGTTTTAGCAATTCTGATTC
TTCATATGAGGGCAATGATGTGCAAATTCTTTACTTATGTTGTTATAAAAGATATTTTTA
AGAGTAGTTTTAGGTTTACAGAAAAATTGAAGGGAAGGTACAGAGATTTCCCATACACCT
TTCTGCCCCTCCACATGCACAGCTCCCCCATCATCAGGATCCCCCAAGCAGAGCTGCTCA
TTTGTTACAGCTGATGAGTCTACACTGACACATCACAATCACCCAAAGTCCATAGTGTAC
CTCAGGTTTTACTCTTGGTGTTCTACACCCCATGGGTTTGTACAAATGTATGCCATAGTA
TCATATAGAGTATATTCACTGCCCTAAATCTCCTGTGCTCTGTCTATTCATCTCTCATTC
CCCCACCCATAATCCTGGCAACCATTGTTTTTTTTTGTTCTGTCTCCATAGTTTTGCCTT
TTCCAAAATGTCATATAGATGGCATCATACAGTATGTAGCCTTTTCAGACTGGCTTCTTT
CATTTAATAATATGCATTTAAATTTCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved