Canis_familiaris Locus Mono:70:SNORA13
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:70:SNORA13
Canis_familiaris
Mono:70:SNORA13
3
SNORA13
1001..1128
2128
TCGCCCCACCGCCAGCCTTCCTCCCGCAGCCCCTCCCCTTTCCTCCCGTAGCCCTGCCC
CCTCCTTCCTCCTCCTGGAGCCCCGCCCCACCGCCGGCCTTTCTCCGGAGCCCCGCCTCC
CCGCCAACCCCTGTCCTCCTTCCTCCCGGAGCATTGCTCCTTTTTTCCTATTCCGGAGCC
CCGCCCCCCGCCAATCCCTATCCTCCTTCCTCCCGGAGCCCCGCCCTCTCAGCAATCCTG
TCCTTCCTCCTCCCAAAGCCCCGCCCCCCGCCAATCACTGGACGCCTTTCTCCCGGTGTC
CGGCCCTCCTGCCTATCTCTATCCTTTTTCCTCCCGAAGTCCCGCCTCACCACCAATCCC
TGTCCTCCTTCCTCCTAGGGCCCCGCCCCACCGCCGGTCTTCCTCCCGAGCCCCGCCCCA
CCGCCAATCCCTGTCTTCCTTCTTCCCGGAGCCCGGCCCCCGGCCAATCCCTGTCGTCCT
TCCTCTGGAGCCCCGCCCCCCGCCTGTTCCTGTTCTTCCTCCTGGCCCCCAGCCAATCCC
TGTCCTGCTTCCTCCCGGAAGCCCGGCCCCCCGCCAATCCCGGTGCTCCTTCCTCCGGAG
CCCCGCCGCACTGCCCATCCGTGGGCCTTAAACCCGCGCGCCCAGCGCTGCGTCTCGCGA
GAACTTGGCGGCCAGTGGTACAGTCCGTCCCCCCCGCGGGCCCCGGACGGTGGGCCCTTC
CGGTCGTAGAAAAGCATTGTGGGAGCGGCGCGCGGCCCTTCCTGTCTCTGCGCCCGGGGT
GGCGGGCGGGTTGCGGCCGGGCAGGGCGGCTGGACGGAGACTCCGGCGCCACGAGTCCCG
GGCCCGCAGCCGCACGGCCGGGCCCGGCCACGTGGTCCGCGGGCCGCAGGAGGTCCCGGG
GTAGGGGGGGACGGCGGGTCTGGCGCGCACGGGCAGGAGCGCCGCGGAGCGTGGGGCGCC
GCAGGTGAGTGCGCGGCCGTCCCGCGCGGGGTTCCGCCCGCGGCCTTTGTGTTGCCCGTT
CACCTTCCGAAACTGGTGAACGCGGTGTCAGAAAAGGCGGAAAGCAAGGCCCTGGCGGCG
CTTCCTGCCCGGACCGTGGGTCTGGGGCGCGCGCCGCCGGGTCACAGTTCGCGCCCACGT
GGCCCGCGTCTCGGTCGCCGGGTGGCGCGTCCCTGCGTGGGCGGCGTGGGGGGCGGGGAC
GGGCGGCCCGCGGACACGCGCCCTCCCGCTGACCTCTACCTTGCGTTCCAGGGAGTCCGC
GGAGAGGAGAGGCGGGGCGAGCTGACGCCGCGGCCCCGGCCAGCGCACCGCACGGGGCCT
GCGAATAAACGTGTCCTCACGCCGCTCGGCTTCGTGGCTGGCTGACCACCGGCAAAGAGC
ATTTTCACCAAAACCCCGAAGGGAAACCGGGTGTGTGTGCCCGTCCCCCCCGCCCCCCGC
GACTTCCGCGCGGCTGGAGCCCCGTAGGGAAGGCCGTGAGGTCCGGGAGACGCGGGCTCG
TCGCGGCCTGCGGTGCCCCGCGGAGCCCCCGCTAGGCGGTCGGCGTGTCCCGGGGGGTAG
GCCGCGGACCCTCGGCACTCGCTTTGCAGGAAAGAGTAGCCCGAGCGTTCAAAGAATTTA
CTGAGTTTTCCAGCAACATACTAGGGAGTGGGAACGCGCGGGTGAGCAAAACAGTCCTGC
CTTCGGGAGGAGCGGCCGGAATGGCGTCACGGACAGACTCCCCTCGGGACACCGGCCCCT
GCAGTTGACCGGGGAGGACACCGGAGCAAGCGCGTGAGCCCGAGGGCGGGGGTCACCTTG
GCAGGGCAGCCGGCCCGTGACCGCTGTTGGGGGCCCGCGGTGCTCCGAGCCTGAACGGGG
AGGGGAGGAACCCGCCCGCCGGAGGCCGCTGACCGAGGGGAAATCAGGACAGGGCAGAGT
GGGCCCGGAGGCCGGCCCCTTGGACCAGGGCGGTGACGCCGGGAGAGGAGGCTCGGGGGG
CAAAGCTCGCCCGACTGTAATGGGATCAGGCACTGGTGTGTGGTCGTGCGTGGTCACCAG
CCACGGGTCCTGAGTCCAGCCGCAGCAGCATTTTAAAGCCGGGCAATTAGGATTGCCTTT
GGGAGATCCACGTGGGGCTGTGGCCACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved