Canis_familiaris Locus Mono:31:SNORA25
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:31:SNORA25
Canis_familiaris
Mono:31:SNORA25
5
SNORA25
1001..1129
2129
CTGAATATGCCAGAATGTGTTCTCGAAATGAAACTATTTTAAACTGGAAGTAGCTGGAC
ATAGCTGATATTTATAAGACTGGGCTAACTTCAGTTTTTCCACTGCTGAGCATGAATAGG
GTTTTTCTTTTCTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
CTTTCTTTCTTTCTTTCTTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT
CTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTT
TAGAAAAGGAAGTTAGTTTAAAAATAAAGCAAACCTCTTGTTGGCATAAGGCTAAGTGGA
GATTGTTCAATTAAAGCTGTTAAATGAGCAGTGAGACCTGAGGCATGTATCCGACTGCCT
CTCGAATATTAAGTCAGTCAAGTTCCCCATGTAGGCATGCTGCCCTCTTCCAAGACCTTC
CACGATTATAAATGCAGATTTTAAAAAAATTGTTTAGTGTCTCTTGCCTCTTGTAAGTAC
CATTCATTTCTTCTTTGTCTCTAGACCAGCTGTCCAATGGAACTTTCCTTAATGGTGGAA
ATGTCCTGTCCGCCCTATCCAATATGGCGGCCACCAACCACACATGGCCACTGAACACTG
GAAAAGTGGCTGGTGCCAACTGAGGGACTGACTTTCAAACTATATTTTAAATAATTTAAA
TGCAAGCAGCCACATGTGGTTAGTGCTACCACATTGGACAGCGAGGCACGAGATGGAGTC
AGATGTATTTCTTTCTACTGAACTTTTGGAAATCTGGTTTCCTCCATTTGGGGTACATCT
TTGTTAGTTCACTGTCTCGCACTTGATTCAAGCTTTCCACACCACCCACCAATTCTTCCT
GATGTGTCCTCAGAACCAAATCAAGGAGAACATTTACAGTAATGTTCACATGGGGAAAAT
TTGAGCACAGACTGAATTCCGATAATATTAAGAAATTACTTAGGTCATTTCAAAGAGGGA
ATTTGGGGGGCTGAAGCCAAGAGCTCTTAACACTGTGACCAAATATTGAAATTCTCTATA
GGATGTAATGGTCACTCAATAGTGCTGTGGTTTCCTGAGGAGATATGAGATAAAAAAGAA
AAAGAAAAAGAAAGAGAGAAATTACTAAACTTGCATACTGGAGTCTTTACAGATAAAATA
AAGTGCTGTCTGCAATTTGCTTTAGATAATGGAGTAGGGAGCGGACAGAGGAAACAAGAT
TGCTTGCTAATTGTTGAAGCCGTGTGATGGGTTCTTGAGCTTGCCTTGGATTAGTCTCTC
TATTCTACATGTGTGTACTTTTTTTAATTAAAAAAAATTAAGATTGGGGGTTGGAGTAAC
TAGGTGATAGGCATTAAGGAGGGCACTTGATGTAACGAGCACTGGGTGTTATAAGCAACT
GATCAATCACTGAATCTACCCCTGAAACTAGTAACACACTGTATGTTAACTAACTTGAAT
TTAAATAATTTTTTTAATTAAGAGTTTTAAACAAAATAGGAAAAATCTTGTCTTATGAAA
TCAAGTAGAAGGGGAAAAAGAGGGGCGCCTAGCTGGCTCAGTCAGTGGAACATATGACTC
TTGATCTCAGGAACATGAGTTTGGGCCCCAAGTTGGCTGTGGAGCCTACTAAAAAACAAA
CTAACAAACCAAAAAACTATTTTAAAAAAAGAAGAAGAAGAAAAAGCAAACCACAAGGGG
TATTCTGGGAGTGCTCAATTGGTTAAGCATCTGCCCAGTGTCCTGGGATCGAGTCCCACA
TCGGGCTCCCTACTTGGTGAGGAGGCTGCTTCTTCCTCTCCCTCTGCCCTCCCCCTGCTC
ATGCTCCCTCTCTCGCTCTCTGTCTCTCTCTCAAATAAAGAAATAAAATCTTTTTTTAAA
AAGCCATAAAATGATAAACATACAATAAAATAAGGAATTTACATAAATGGAAGGAAATGC
ATAATATAATGTAGTGGTTAGGAGCCAGATGGCTGAGTTCAAATCCTGGCTAGAATACCA
ACCTGGTTTCGGGAATTTATTTGAGCTTTGCTCAACCTCTGTTGCCTTATCTGTGGAATG
AGGCTCAGGCTGGAATGTACTTCTTAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved