Canis_familiaris Locus Mono:3:SNORA9
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:3:SNORA9
Canis_familiaris
Mono:3:SNORA9
Un
SNORA9
1001..1132
2132
GGTCTCCAGGATCAGGCCCTGGGCTGAAGTCGGCGCTAGACTGCTGAGCCACCCGGGCT
GCCCTGTTCTTTATTTTGTTAAGTGAATGTTTTCCCCATTCCCAAGGCTGAGAAGAATTC
AGTGTTTTCATTCCTGTCCCTGATGCCCATCAACTAGCTCCCTCGTGAGAACAAAACGGC
TAGCAAGTACCTAAGTCGGAGCTCCTCGCTCCGCTGTGCCCCCGGGGCCCCCGCCCCCCG
CCGGCTTCCAGCCGCGCAGCCTTGGCAGCTCCGTGCGTCCAGAGCGGGGATGGAAGTAAA
ACCCCACCGCCCTCCGCCCAGACGGCCGCTCCGCAGAGGCAGGGAATAAAGAAAACATTT
CTATGGACAAGGATCAAGGCAGAAACGGATGCGCATCGCGGGCACCGCGCTGAACGGCTG
CTCGGCGTCCGCGGGCGGGGCGCCGGACCGGGCCTAGCTGCGCGCTCGCCGGGCCGCGGT
GGGCGCCCAGACGTGAACCGGAAGGACCGGGCCCGCGGCCGGGGCGGAACTTCCGCCTGC
GCCCTGTGACGTCACCGCACCCGGCTTCCGGTGGGCTGCGTGAGGACGCGACGCGCGGCG
GGAGGAGGAGCGCGGGAGTCGTGTGTCTCTGGCGACTCCGGGGCGCCGGCATCCGAGGCC
ATCCGAGGCCGTCGGGGTTCCAGGCGGTGCCCCGCCGCACCGGCTGAGGCCCGGTGAGCA
GCGGCCGCCGTGCGGGCCGAGCGCTCGAGGCGATGGGGTCGCGGCTCGTCGGAGCGCGGC
GCGGACTGACCCCCCCGCTCCCGAGCCTCCGAGGGCCGAGCGCGGGGTAGTGGCGGCGCC
CGGCCGTCCCGGAGCCCGCCCGAGGGGCTCGGCCTGCGGCTGCGGAGTGCGAGCGGAGCG
CGGCCTGCGTGCGAGGAGGACTGCGGGGAGAGGCCGCGGCGGGGCGCGCTGCTGCTGGGC
GTCGGGGTGCGGGGGCGCCCCGCTCGGCGGCCCTCGGGGCCCGGCAAGCGTCCAGCGTGC
TGGGGTCTGCGGTGACCCTGTGCATTCCTGCACCGCTTGCCACAGCATCCTGAGACGGTT
TGAGGCCTTGCCCTGCTCCATCCAGAGCGAGGTTATAGAAATTTCAGACAGGCTGCCGCC
TCCTCCGGCTGCCGCGCTGACCTGGGCCACGTGTGGTCCCACGAGGCTGGTCAAGCGGCG
ACGGTCGGGGACCGTGCAGGTTGCGGAGCCCCCCGCCTGAACAGGCGCTCGGGACTGGGC
CGTTTGCTGGGTGCCCGGCTCCCTGCTCACGCTGTTTCCTGACCCTCCACAGCCCCACGC
ACGCTAAAAATGAAGCTCAGGAGGAGTGGGGCCGCCCTCGGCAAATACCGCGTAGAAGGA
GCGAGGGGCAAGGCTGGCCCCGCAGAGCCAGAGGTGAGGTTCCGCGCCCGCGCTGCTGCA
GGGAGGCTTCGGGACCAGCCGGCTTGCTTGACTCGTAAACCTTAGTTCCCCGCGAGGTTC
AGATCTTTGACCACCAGGAGGTGGTCTCGGTTGCACACGAGCAGGGTCGCCCAGCCAGAA
ACCCCCTCCAGGCATCGCGTCTGTTCCCTTCCCCATGCCTGAGCAGGAGGGAGGAGTGGG
ATCTTGACGTGGGTGGAGGGTCATGGCAGGGCAGCAGAGCCTTGGGCTCCTTTGGGTGGC
TGGCCAGGCCACACCAACTCTCCGAGGCCAAGGCTTCCCGTAGACTTGGGGTCTGCTGTG
TCTTCTGTCCAGGTGCAGACACTGAGCACACTGGGAGTTGGCTGCACCTTGGCTCATCTT
TTTCTTTTTTCTTTTCTTTTCTTTCTCTTTCTCTTTCCTTCCTCCTTTTCCTTTCTTTTC
TTTCCTTCCTTCCTTCCTTCCCTTCCTTCCTTTCCTTCCGGTTTTATTTATTTATGAGAG
ACACAGAGAGAGGCGGAGACACAGAGTGAGAAGCAGGCACCATGCAGGGAGACCGACTCA
GGACTCAATCCCAGAACTCCAGGATCACATCCTGGCTGAAGGCAGCGCTAAACCGCTGAG
CCGCCAGTGCTGCCCATTGGCCCATCTTTCTGAGGACGTTCGTGTGGCATGCAGCCGCAG
GATGGAGGAGGTAATACAGAGCTGGCCTGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved