Canis_familiaris Locus Mono:36:SNORA2
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:36:SNORA2
Canis_familiaris
Mono:36:SNORA2
4
SNORA2
1001..1130
2130
TAAGAAAAAGAACTAAAATTAATTCTGAAAAAAGAACTATCTTTTATTTATACTGTAGG
AAACACTGAATAAAAAAAACCCAGACTTACAATATGGCTAGCCTCAACAGAGAGAAGGCA
AATGTCACTCTAGTAATAGTTCTAATATTTTTAAAAATAAATATTTCTAATATTATTCCT
AAGGCTATCCAATTTACTTAAAAGAGAATGTTGACTTAAATCTCTCTTTTACATGTTAGT
TACAGCAGTTTCAGACTTGTTATCAAGTCATTTAATGCCAAATAGCTTTAGAAAAATGAA
AAATAGCAGCCAACAATCACTTGAAATGAATAATAAAGTCTCTCAAAATTATGTTAATTT
TTTTCCCAAATGGAGGTGTTTTTAAGGGATTGTCCTTGACAGTAGAGACATAATTCAGTT
TTTTAAAAAAACATGTTTATCTGTTAACTAAATGTAGATTTAGTTCAGTCCCTCATAAGT
GGCTTAATGAAGTCAGTTGTTTACTGGGATGGTTTTGTTTTTAAAATGGTACTCCTAAAT
CTATGACTAGTTGTAACTTGAAGTATACTTTTCCCTGTATACAATTTACATCTGTGGTCA
TTTTAGGAAGAGTATGATTTTAGCATAATGAGTGAGGATCATGAGATTTGTTTATATAGC
TGGTTTTTTTGTCTGTGAGCAACTTTATATTAAAAAAATCAAAGGACTATATATATTTTT
TTGCCTTGTTTTTTCCTTTTTTTTTTTTTTTTTTAAAGATTTTATTTATTCATGGGAGGC
ACAGAGAGGCAGAGACACAGGCAGAGGGAGAAGCAGGCTCCTCATAGGGAGCCTGAACGT
CAGGCTTGATCCTAGGACCCTGGGATCATGACCTGAGCCAAAGGCAGATGCTCAACCACT
GAGCTGCCCAGGTGTCCCACTGTTTATTTTTGAAGCCAGTTAAATGCCTTGCCGAACAGA
GGTGTATAAAGTGAATTAGAGCTTTTTAACACTTCATCAGCATAGCCCTGAATCCAGACC
AGTGGTTTGCTAGCTGTTGGTTTCAAACAGGAGCCAAGAGTAATGTGTTTCTGTGGTCTG
TAAGCCATTCAGCACCCCATTGGGAATGGCTTTCAGTTGGAATGAACACAGTTTATGGAG
GGGGAAAAAAAAAGAACTTTGTCAACAAACGTAGTTCGTGTTGATGAGGTGTATGTGAAT
CTATGATGGAGAGCCCTGGTGTAGCCTTAGCAGCACACATGGTTTTTTCAAATACATATC
CTACCTTTCCTGTATTTTGTTTTACCCACATAAATTCCCCTCGAGGCTAAAACTTGGTTA
ATCTCTCCATGACATTGTACATGGTTATGAATACGGAAGATGCTCTTTCATATTCCCCAA
TGAAGGGAGATGTATGTGGCATTAGAAGATTGCACAGTCAGGCATTCTGGACCTGACTAC
CTTCTTAGGAGGCTTATGTCCACACTGCATTCATGGCCTAACTAGTTCATTGTGTGTTGT
CAAGCCTTTTCCACCTCTCTAAGCCCTCCCACCTAATCCTACTCTACTCTGTTTTTTAAA
GGAGTCATCATGAAATCTTATTTTCTTTGCCATGGATCAGGGTGGTGATTCACAAATCAC
TTAGGATCTCTGGGCCTCATGTGGGGTTTTTTTTTTGTGATAAGGAGGCCTGTTTTGCCC
ACTAGATGCCAAATGAGATGAGGTCTTTTCTCTACTGACCTAGTGTTCTATAGCTTGTTT
CTAATTAATGTTTTTCTAATTTTAGATAGTACCTTCTGTATTCTACATGACGTCTTATCC
ATTTGGGCTGTGTTAACAAAATACCAGAGACTGGGTGGTTTATAAGCCACACAATTTATT
TCTCACAGTTCTGGGAGCTGGACATCTGAAGTCAGAGTGCCACCATAGTTAGGTGAGGGC
TGTCTTCTGGGTCACAGACTTCTCTGTCCTCACGTGGTAGAGGGGCTATGGAGCCTTGCG
GGGGTCTCTTTTATAAGGACACTAATCGCATTCATAAAGACCTCATGTTCGTGATCTAAG
CACCTTCTGAAGTCCCCACCTTCCAACAGCATCACTTGGGCTTTAGGATTCTCAATGTGA
ATTGGCGGGGCAGTGGGGGGGTGGCACACAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved