Canis_familiaris Locus Mono:119:SNORA36
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:119:SNORA36
Canis_familiaris
Mono:119:SNORA36
2
SNORA36
1001..1121
2121
CACAGATTTGCTTTGATAAGCTGTTCAGCCTCTCTGTGTCACACCTCTCTTGGCCAGAG
CAAAAGAGAAAGGGTTCATCTATCCCACATAACAGGATGAACAAAAAATACAAAATGATT
ATAAAGTACTTTGTGTAGCATCTACACAACAGGCATCCAGAGATGTTGCTTATTCGTATA
AAATGCTTTGTGAAATGTGAATAACCAATGCATTAAACCATCGGCTCTTATTAACAAACA
TAACAACACCTTCTATTTCCTAGGCACTAATTACATGTGAGGCTTCCCTTGCTCTATTCC
TTCTTCATGGCACCAGGATGAGAGCAGTATGCTTAACAGCGTTGTTTTACAGATGAGGCA
GCTGAGGATCAGAAAGGTTAATGACTTGCCCAGTCATGCAATCAGTGAATGACATAGCAG
AAACCCAAACCCAGGTCTATGAGAATTTCCCTTTTTCCTGGCCTTTCCCAGCCCAGTCTG
AAGTAGGACCATCCACTGAGTTCCCCCAGTGGACTCTGGCCTCACCCTAGCCCTTTGAAA
GGAATGGCAATTGATTCTACTGTGACAAAGGGTCAGGAGGGATTTGACTGTCCCTGGGTC
ATCTTGGGGAAGCATCACAGTGACAATCAGAAAAGTGCTGGTGGGAGTATTTATAGCTGA
GAAAGGGGGACTGTTCTGTGTCAAGGGAGGAACTTGCAAAAGACTTCATTCAACAGACAC
AAGTATCTGTCGATGGAGCTACATGAGTTATAGGGGCAGGGAGGGTGGGGGGGGGAGTAA
ACAGAAGAGAGAAGCTAAGGATCATTCATCCAAAGGGCCTTTTGTCTTTTTCCCGTATTT
CCATGGCAGTTAAAATTATGGACTCTGCAGTCAGAAAACCCTACGTTCAGATCTCGGCTC
TAACATTGATTTATCTGTGTGACCTTAGACAAACTATTAAAACTATTTAAACTCTCCAAG
CCTTGGTGTCCTTAGCTGCAGACTGGGGATTAAAAGGCAATGCCTTGAGTTCAGTTCAGG
GCAGCCCCCCTGCTTAGTATTAAACTCTGGGACATGACCAGGCTAGGGTAGATGATTACA
TGGGGAATATTACTCTATTCATTTATCTCCCAGCCTACAAAAAGAGAGAAAGAAAAAAAG
AAAGACAGAAAGAAGGAAGGAGAAAACGAGGGAGGGACAGAGGGAGGGAGGAAAAGGAAA
AGCAATGCCAACCTTAAAGAACTTCTCTGAGGATTAATTAAAATACTGTATGTAAAGCAC
TTAGGACAGTACCTGGTACATAGTAAATGTTTAAGAAAAGGTCTTGCAATATTTTATTAT
TGATGGACTTATCTGATTATTTATGAGTATGTCCAGAACAGCCTATTGGGAAACATACGG
TAGGGCAAGCCCTCAGCATTTCCAAAGAGATAACACATATTTCAAAAGACTGAGCTTGGA
AAGCCAAATTTTGTAGGTCATGAGGGAAGAACAAGAAACACCTAGCAAGCCGACCATCTT
CCTATGAGTTGGGAGGTCTGCTGTCTCTGAGAAAAGAATGTCCTTGAGGGCTGGTTCTGG
AGATTGTAACTTGCACAACATTTTCAGAAGAGTTTTGGAGGCACATCCACAAGGGAAGGC
TAGAGGATGGGCCGAGGGCTGCCAAAGCCCCTGCAGAATCACTTTGCATTTGGCTGGAAG
CCCAGGGCTCTAAAGCATCAGTCTGTAGAAAAGATACTTCCACGTAAGATGTGTGTGGGT
CCTCAGCATGGCCGAGAGCCTGCAGGATGCTCTGTACTGGGGTACACCATTAATATTCAA
GCAGAACTGGGGCTTGCTCTCCATGACGCTGCGCCATGGAGGGCTCTGCTTTTCCTCTTG
GAGGATGTTTTCTCTAAGCATTAGAATAATTCCTGACGTCCAACTGAATAACGCTCTAGG
GGGGTCAGCCTTTGGGGGATGGATAAGCCCCACTGCAGAGAATTAAAGCTCCAGAACGCA
GGGAACAAGTAATGGATACTGCAGGAGGTCCCTGGGAATGTATGTGTCTCTGCTTCTGTG
TCCTACTCCTCATGAAGGAGTGTGGGGTCTAAGACTGGGACAGAGCTGCTGGGTGATACA
GCTGGACTGGATTCCCAGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved