Canis_familiaris Locus Mono:123:SNORA70
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:123:SNORA70
Canis_familiaris
Mono:123:SNORA70
2
SNORA70
1001..1140
2140
CTAGTCCCACGTCGGGCTCCCTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGC
CTCTCTCTCTGTGTGTCTCTCATGAATAAATAAATAAAATCTTTAAAAATATATATATAA
CATTTATTATATTGGAGAAATTGAAAATATTTGTACAAATATCATGCTGGATGTTTCTAG
CCATTGGTTATCGTTTTGCCTTTTGAAAAAAAACAGAACAAAATTTAGGTTTTTTGTTTT
TCTTGACAAACCCTCTGAATATTTGAACTTATCTCTATGTGAAACATGTTGAGTTCATTT
ATTTTGCATTTGTTTAATAAATGTTTAATTGACTTATTTTTTATTTTTTATTTTTTAAAA
TATAGTATTTATTTATTCATGAGAGACACGGGGAGAGAGAGGCAGAGACACAGAGGGAGA
TGCAGGCTCCATGCAGGGAGCCCGACGTGGGACTCGATCATGGGATTCCAGGATCATGCC
CTGAGCCAAAGGAAGACACTCAACCACTGAGCCATCCAGGCATCCCTTAATTGACTTTTA
AATAGAGAATGGAGAGTTGGCTGCACAAGGAAAGCAGAAAAATGGAGAGGTAGCTGGTAA
AAGATGAGTAGCTGGAGAATATGATATCTAGAGAAGTTGGCTTGTTTTGAGGTGGAAGAA
ATTATAATACTTTTTTTTTTAATTTTTTATTTATTTGAGAGAGACCAAGAGAGTGGAGGG
AGGGGCAGGGACAAACAGACACTGTGCTCAGTGAAGAGCCGCACACACAGGGCTTGATTT
CACAACTCTGAGATCATGACCTGAGCCGAAACCAAGAGTCGGACACTTAACCAACTGAGC
CACCCAGGCACCCCTACAATACTTTATTGTAACACTGCTTATATAATAGATAATCGATGT
GGGCAGGAGAGTTTGACTGGATCCATGTTCTTAAGTAGGGGAGAAGGACTGCATACAGGA
TGGAATTGGCTTTGGGAAGGAGTATAAAATGGTTCATCTATCTCCAGCCAATTAAGCCAA
ATGTTCTGTTTGGGGCACACCCCTGGGGGCTGGCGTGCAATGGCTGCAAACAGTACCCTC
CTTGGTAGTGTATGCAGCTTGTTGCTTGAAGGGGTTGCCTTCAGGGACCTTGGAGACAGT
GGACGTTCATGTCTGACCTCATGCTGTCCCCAATCTAGGCTCCAGATAGGTATACAGGTG
CCTTTAGAAAGCCTCAGGGCATAGTGACCAGAGTCCACATTGGCCAGGTCACTATGTCCA
TCGGTACCAAGCTGCAGAACATGTGATTGAGCTACCAAGGAACATGTGATTGAGGCTCTA
AGCAGGGCCAAGTTCAAAATCCCTGGTTGCAGGAAGATCCACATCTTCAAGAAGTGGGGT
TTTACTGGGTTTAATGTGAACAGAATTAAAGACATGGTGGCTGAAAAGCATATGCCCGGT
GACCATGGGGTCAAATACATCACTAATGGTGACCCTCTGAACAAATGTCATGCCCTGCAC
TCGTGAGAACTTTGATACTGCTCTCTCCTTATTCATACCCATCAATAAATCCTACTTTCT
GTCCAAAAATAATAAATGGAGGGGCAGCCCGGGTGGCTCAGTGGTTTAGTGCCTGCCTTT
GACCCAGGGCCTAATCCTGGAGACCAGGGATCGAGTCCCACGTTGGGTTCCCTGCATGGA
GCCTGCTTCTCCCTCTGCCTGCATCTCTGTCTCTGTCTCTCTCTCTCTCTCTCTCTCTCT
GTGTCTCTCATGAATAAATAAAATCTTAAAAAATAATAATAGATGATAAATAGAAATTGT
TCCAACTTAATAAGAGAAATGATGACATCATACAGCAGTCAAGAGGTTTTGATTTACTTC
CTATGTTCTTGGGCATGTCTCGTAAACTTTTTTGGCAGGATCTCTGTGTGGTATATTTGC
TACCAAATGATCATTTTCTAAAATAGTGCCTGGCAAACAGTAGTTGTTCAATAAATATTC
ACTGAATTAATTTTAGGAACTATCTATTAAACCTCTATACTACATATGCCACATCTATTC
CACGGGGTTGTTTCAAAGATCCAATAAAACGAGAGAATGGAGTAAAAGTGCTTTATCATC
CAAGAAATGCTATTCAAATCAAAGGTGTTTGTGTTTAGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved