Canis_familiaris Locus Mono:47:SNORA42
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:47:SNORA42
Canis_familiaris
Mono:47:SNORA42
33
SNORA42
1001..1136
2136
AGGGACAATTTCAGGCAAGCTATTCTCCCTCCTTTCCTTCCGAGCAGGATGGTTAGTAG
CCAGACTCCGGGCCTGAGCTTCCTCCAGGCTCACCAGCTTCATGGGCAAGGAGAGGGCTG
GCAAGGTCAGGCTCTTCATGATGGGCGGGTTTTCTATACAAAAAAGAAAAGAGCTCAGTG
GTGGAAGGAGGCCTGTGCATCTAGTGTAGCCAGATTCCCCACCCACAGTGCCTCCATTCC
AGACCCCCTGGCTTCTGGGGGTTGGGGGCCGAGGCTGCACATAAGGAACTGACAACTCCA
TGGCCAGACAGCCAGCAGGCATACAGGGCTTCAGGAGAGGTAGCCTGTACTTCTTGTACT
TTTCAGAGAGGGACCATTCGTTCATTCATTCATTCATAGGACAAACATTTACTGAGCATT
TACTTCCTAGTACTTTGGCCAGGGAGGAATGTATGTCCAGCCATAGACATGGCCTCGCTC
AGCTAGAACAAGGCAGGAGACTGTTCCTGCTCTCTGCAGCCACAGCACACACACTCCAAG
GCAATTTAATGTGGGAGCCTATACTTTCCCTGATCACTAATGTTTATATCTCTGCACTGA
AAAGACATTTTATAACCTGTACTATTCCTTAAAACACAGATGGCTTTTTACTCACGACTC
AGTGGTATTAAGTGTATGCAAGCTAATCTTTTCTTCCTATGGTTTTATTTTTGTTTGTTT
TTTGTTTTTGTTTTTATTTTTTATTTTAAGAAATGGAAGTGATGATGAGAGACCAATGGT
GTCCAGGGTCATCTCCTTTCTTAAGTTATTGGTTCTCAACTTGAGGCAATTTTGCAGCCC
AATGCCGCTTCCCCAGGGACATCTGACAATGTCTGGAGCACTTCTGGTTGTCATAAGCAT
GTGTGGGAGCACTCCCGGCATCTAGTGGGTAGAGGCCAAGGATGCTGCTAACCATCCTAC
AGTGCACAGCACAGCCCCCCAACAAGAACTACCCAGCACTAGCACATGGGGTGCACTGAT
GGTGGGCCCTTCTCTGGGACCCTCATGGTGTACCTGTGCCAGAGGAGCAAGAAGCCCCAC
GCCATTGTCCAACCTCCTTACCAGTGGGCTGTGAGCACTGAAGGGGGCTATCTAGTGTGG
AAAAATAAGAAAGGAAAAAAACCCCAATGACACATACAAACAAAAAACCAAAAACCCCCC
AAAAAACAAAAAAGAACTATGCAGCACAAAATGTCAGCAGTGCCAAGATTGAGAAAACTT
GATCTAAGTAAACGAAGAGGACGTCTAAGTTGGCCTCTGAGTGGTCTTTGGCAACCTTGC
CAGCTTCCTGTAATACCTTCAGAAGGTGTAAAGAGACTCAAAGATAACTTGGACCAACCG
AGAGTCAGCAACCATTTTGGGTATTGGACTCACCTAATTTTCAGAGAGCACCCTGATGGC
ACTATTTCGCTTTGCAGAGCGTGTGACCCTCTCTGGGAGGAGGAAAATAAAACCACTGAA
AAAGGGCCTTGAAGGAAACAGAGACGGTACGGAACACTGGGTTCTTCCAGGCAGGACAGC
ATGACGGTCATTCCTCAGGACTGCAATGAACTAAATGAACTAAATCCGCAATCCTAAAAA
CTTCTCAGTAGCTTCTAACTTGAACCCAGTTTTTCAACTTAATCCCAAGGAGGTTAAAAT
ATTTAAATTTTCTATACTCTTACTATTTGCATTTTGATTATTTGTGATTTGTTAACTATT
TATTTACTTAAACAATTCAATCACTCTGGGAACAACTGGATCGATGCAAGAACCTACACT
GCTGGGTCAAGAGACCTCCCAGCTGGTTTAGCACCCACCTCTCCCCCTACTTTCAGGCTG
CAGGGTCCTAAGGCCTGCTCATTGTCTCTGCTTAGATGTTTAACAAGCATCCCTAACTTC
ACATTTCATAACAGAGCTTGGGGTTGTTGCTCCTTCCTCTAAACTGGTACCCTTCCCATT
TTCGTTAAGTTAGTAAATGGCACCATGCGCCACCCAGCTGTAAGCAGAAACCTGGAGTAC
TTTTTTTCATTCATTCCTTTCTTTGGCATGCCACCCATTCCCACATCTAGCCTAATAAGC
AAGTCATATAACATTTTTTTAAAGATTTTATTTATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved