Canis_familiaris Locus Poly:21:SNORA71
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:21:SNORA71
Canis_familiaris
Poly:21:SNORA71
24
SNORA71, SNORA71, SNORA71, SNORA71
1001..1134, 1336..1465, 2392..2524, 4348..4481
5481
GCAATCCTCAGGCATCCGCAGCCCCCGCGCCGTAGCTCGCGGCGCCCGGGGTGAGTCCG
GGGCGGGGGTCGCCGGGCGCGTGGTCTCTGGGCTCCCACCACCTTAAGGGGAAACTGAAG
CCCGGGGCGGGCGCGGAGAGCCGGCGGAGGTCAGCCCCGGTTCCCGGCCCCGCTCCCGGC
TCCGGGGTTGGCCTCTGCGGGCGGGTCCTGGAGGAGGGGCTCCCGGGACGGTCCCGCTGA
GCGCGGGCGGCGGGTGCGCAGCCGAGGCGGCCCGCGGCCCGGGATGCGCCCCCGATCCCG
CCCCCACCTCCCACCCTCCGGCCGGCTGCCTACCAGGCGAACGGAGCCGCCTGGGCCCGC
CTCGCGGCCCGCAGCGCTCGGGAGGGAGAGTGCGCGAGCCGGGCCGTGCGGAGCGCGTGT
CCGGGCCTCCAGTCGGCGGCGCCCGCGGGCCCCGAGCGGCCGAGGGTGGTTCCCGCCTCC
CCCCGCTCCTGGTGCCGGGGCCGGCGGGCTCTGCGGGACCGTGACGCGCGGCGCCCGAGG
CCGGCCCTGTGTGCAGGGGTGAGGCCTGGGTAAGTGCTGCCGCGCGTGGGGGGGCGGGGG
GGTCCCTGGAGCTCAGGCTCTGCGGGAGGAGGCCGGAGGGGGCCGGGTTCAGATCGTGCC
GCAGCCCGGGGCCGGCCACAGAACCTTGGCTCATCACTTCCTGGTGCTGCGCTTCAGCTT
CTTGCAAGTGCGGAGAGTGCCAGAGCTCTGGAGGGACGAGAGTCCTTGCGGGTGTCCTTT
GTCTTTGAGGCCACAGTGCCCGGCACGTAGTAGGTTCTCAGGCTGCGTTTGTGGGGTGAA
TAAGCAGTTGAGGCGATCTTGCCGGGAGGTGGTCTTCCTGTTGATGACGGGAGGTGGAAT
CTTTGCACCAAGTGCTGACGGTGCTCGGGGTCCTGGGCTTGGCGGCGCAGCTGGGGGCGC
GGAAGGGCTTCTCTTCCTGGCTCACCGTGTGTCTTTTGTGCACCTGCATTCGAAAGTGAT
CGTGGTCTGTCGGTGTCCTGGTCATTGATAGTGCAGGGAGAGGAGTCGCTGAAAGCGCTT
CCCCGTGTTTGGAGGGTCCACTCCTGTCCCTTCCAAACTCTGGAGCTTTCCCACACTTGC
TCCCCCTCACCACCTCTCAGGTGCCTCCTGGTGCCGGCCGTCTTGCATGCTCTCTGTGCC
TGGCTGGGCGAGGTTTCTGTCTCTGAGGCTGTAAAGGGGGAGCAGGGTGTGGGTCCTCCC
TCAGTGCATGTCTGAGTTGCTTGTCTGGTCTTCTGACACTGGTTTCTGATTTCAGCGGCC
CGGTGTCCCTTTCTGCCCCTGTGTTTCAGGTGATTACGGGCTGCCTCTGTCCTGGTCATT
GGTAACACAGGATGAGGAGAAGCTGCAAGGTTTTCTTGATGTTCACAGGTTCCAAAATGG
GACAGCCTGAGGTGACGGAGCACGACGAGGTAGGTGGAGGGAGGCGGGCTTTTAGTGCCT
TCACCTCCTCAGACCAGATTCCCCCAGCGTTTCCCTGTTAGTGAGCATGGTGATTTCCTG
GATGTGTAAAGCCACGCCAAGTGCTTCTTGTCCCCTGCAGGAGGGTCTCATGTCTGCTGT
CCCACATATGTGAGAGGTGACCTCCGGGAGAACCAGGATCGGGAGGTCCCAGGTGAGCGG
TGTCCTGCTTGGGTCTCTAGAGCTTAGGGCTGTGAGGCCACAGGTGTTCAGATGATGTGA
TGTGGAAATGAGTGCAGGTGAAGGCTGCTTCCCAGTGTTCCCAGCTGTCTGTCCCCTCAA
GCAGGTCTGGGCCCTCTTCTCCTGAGAGCCCCCAATGAAGGCTCCTGTGACCTGGAAAGC
AGCAGTGTGGGGATGGACAGAGGGCTGCATTTTATTTTATTTTTTTAAAGATTCTTTATT
CCTCAGAGAATAGGAAGAGAGATGCAGAGACATAGGCAGAGGGAGAAGTAGGCTCCGTGC
AGGGAGCTGATGTGGGACTCGATCCCGGGACTCCAGGATCACACCCTGCACTGAAGGCAG
ACACCCAGCTGCTGAGCCACCCAGGCGTCCCAGAGGGCTGCATTTTAGAGGCAAACTGAG
ATTTGTATTGGGTGCACGGCTGAGTGCTGTTATATGAGCCTGAGTGCTGTTAGGTGACCA
CTTACACTCAGTCTTCCAGAACCCAGGAATCCTCAGTATTTCTGCACTGTTTGTCTTCCC
TTCATCTCCTGGGTGGGCGTGGTAAACCTCTGTGTGAGTAAGGGGAAGCTTCTGTAATCT
CAGGCTGTTAGTCTGGGCATTGGCCTGTATGCCAGGCTCCTAGTTCAGGCCAGTTCCTGG
GTTGCTGCCCAACCAAGCCTCCCTTCTTGGCCCACTCACTTCCCTTTTCTGCTCCTGCAT
TCGAAAGTGATCGTGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGGAGAGGAATTGC
TGAAAGCACATCCCCGTGTTAGAAGGGCCCATCCCATCCCTTCCAAACCCTGGAGCTTTC
ATACACGTCTTTCTTCCCACAAATTTGTGTTAATTCCTGGTACTCGGGGCTGTGTGGCTT
GCCTAGTGCCCTTTTTTGCCAAGCAGGGCCCTGCCTTGGTGCTTCTGTTCCTGGGCCAGT
GGTAGAGCCATGGTGGAGGTCCCTCTTCTCCCAGGGCTCCCCCCAGGAAGCTTTCCCTGC
CTTCACATCCCACCCTTCCCACTCCCTCACACCATCTTTCAGCCCGGGTCACACTGGACA
TTGGTGATTTGCTTGTCATGCCTCTTTTGCTGTGGTCTTAAGGGCAGTGCCTCTGCCTTG
GTGTCTAATCTGTAGTACTTGGACAGGGCAAAGCAAGGCGGAGGAGACTGAGATGCCACA
TGGTAAGGCAGTGGGCCCATCCCATTGTACAGTGTCACTGGGAAGACAGCGCCCCAGAGC
AAGCCAGCCTGCTCAAGCTGAGGCATCCTCCTCTTCTTGGAAGTGTTTCTCTCATCTTGG
TCATGGGCTGGACCCATGGTGCCCAGGGGATGATGTTTCTCTGTCCTTAGATTAAGGGGC
AGGGAATGGAGTAGTAATCCACCTGGGCAGAACACATGATAGTTGGCACATAGGTAAGCT
ACCCTTACACACTAGATGGAGGACCCAGGGCCCTCCCACCACCTGTTTCCCCTCTCATCC
CAGGCTTATGGCTTCCTGTCAGCATGGCTCTCTCCCTAAAACTCGGCCTTGACAACCTTT
TGGCATAAACTGGTTAGCAACAGATTGAACACAGGCACATAGGTTGATGTTGATGTTATC
CTGTCACAGATCATCTGCAGACCCCTTTCTAGAGTTAAGTTTTTGTCTCTGAGATAGTAG
TGTGGGACCGTTAAGGAATAGCAGTAGGCCACGTTTGTGGGTACTCTAATCTGCTAGCCA
CTGTGCTGGGTGCCCTCTGCCCACTGGGGCCTGCCGAATGCTCATCTGTGCCTTGTGTTT
TGTAGGTGGGTCTGCACTTGCAGAGGCACCATGAGAGGTGTCATCTCTTCAGTGGGCACG
AGGCCATGGGGCCCAAGGTAAGGTGTTCACATCTCTCTGGAATCTTGTGCCCTGGGGTTT
AAATGAGAAGTGAGATGAAAGTGTATGTCTTGTGAGCTCGCAGTTGTCCCCTCATTGTGG
GCAACCCCTCAAGTACCAAGAGAGGATGGGCCTCTAGAAAGCTGCTCAAGTAGGTGAGGG
GCTTCCCAGGGCAGCTCCCTAGTGTCAGCAGTGGGCCCTGATGGAAAGCATGTGGATTTA
GGCACCAGAGACCCTGGTCCAGCCTCTGAAATTACTTAGTTTTGTGACCTGTTCTCAGTC
TCCACTTCAGCAAAGCATAACTGGGATAATGGTGAAATGTTTTAAAATTTTTTCATGGAG
TTGTCGTGACCATATGATCCTGATTTTTTCCAACTCAAAAGCATTTCTGAATTTTTTTTT
TTAAAGATTTATTTTAGAGAGAGAGAGAGCGTGCGCATGCAGTGGGGAGGAGCAGATGGA
GAAGAGAGAGAGAGACTCTCAAGCAGACTCCACAGTGAGCACAGAACCCCCAACATGGGC
ACGATCCCACAACCTGTGAGATCATGACTTGAGCTGAAACCCGAACTGGGCGCTTAACCA
ACTGAGCCACCCAGGTATGCCAGCATTTTCAGTGTTTTATGCTGGAAGTGTCTTGACTCT
CTGGCATGGAGGTGTTACAGGGTCTCTACAGGGTACACAGAAGCTCCTCTGTGTTTGGCT
AGGGCTGCTCACCCTCCCTCAGGCCATTCCCCAGACCCCTGGCACCATCCTCCCCATCCT
TCCAGGCTCTCTTTCTATCCTTTTCTGCTACTGCATCCAACAGTGATTGCAAGCTACCTG
TGCCCTGGTCATTGATAGGCCGGGAGAAGAATCACTGAAAAAATTCCTGTGTGTGAGGGA
TCCAGCTGTCCTGGAGCTTTCTCATGCTAGCTTTTTTTTCTCCTGCTGTTCCTTCAGAGC
TTGGGCTTTTGCGGGCTCCTATGTGATGTGGTGACTGGGCTAGCCCCCTGACCTGTTGGG
GGCTCTTTCTGTCTTTTCACGTTACAGATCCTCTTGTCAGCAGTCAGTCTACACGTTTCT
GTATGGGTCTCTCACTGGAATAAGTCCGTATAGCACTCAATGGCACTCATAAGAATTGCA
AATCATGGGTTCTGCTTTATGAATTTATGGGAGTGGAGGCTAGCCCATAAGAGCACATTA
GTCAGGACAGTGTGTGGATGCATTGCTCATGTGTGTTTTGTCTTTGCTCCTTTACTCTTT
CTTGAGCACAGTGTGGATTGCTTCAGGAGCTGTCAGTAATGTTAAATAAATAAAGAAAAA
TCTAGATGGGGCCTGCACTAGGGGCATGGGGGAGTTACCATGTCATGGTCTGCCAGCAGT
TGGAGTTTTCTTGTCAGTCACTGATGGAGGAGAGTGTTGACTTATAATCTTGCCTGTTGC
TCGCCTTTCACGGACTTCGTCTGTGTCTTGTGGGTTCTTTTAGAAAGGGTAACCCTAGGG
GTTGACTGGAGAAAAAACTTTCAGGCCGTGGATCTTTGAATCTGTATTGTAGACTGCGGA
CTTCCTAGCCTGCTTTCTAGTTCACGTCTGTAGGACATTGTGACTGGGTGCTTAGTGTGG
TCCTCCATCCACAGCAGGCTGACTGGCTGCTGCCTTTTGTGCTGTGCACTGCCGATGTGT
TCAGGGAGCAGAAACCCTGCAACGGTGCTTTCACTTTGTATACTCAGATACAGCGTGGTG
CCCCTGACAGATACAACATGGTGATGCTAAGAGCCCTGTCTTGGCTCCCAGGTAACAAGG
GCAGTGAGGTTTGAGGTCAAGGTGTCCATCGCATTGACACCCCCCCCCCCCCCCAACTTT
TGGTCGGGGCTTCTGTCTCGTTCCCGAGACCTCTTCCCTTTATATTCAGGTATTGTGTTT
GCAGATGGGATCCCTTTGTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved