Canis_familiaris Locus Mono:51:SNORD113
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:51:SNORD113
Canis_familiaris
Mono:51:SNORD113
8
SNORD113
1001..1076
2076
ATGTGACATTCTCCCTGCGTTCTCATTCCACTTAGCTAATCCCGGAGAACACGGGCCAG
GGCATTGGCTTTTGGGGCCTCTTAAAGACCGAAAAGGAAAGTCCACCCCGATGGGTGCAT
TGCAGACACCCCCGCCAGGCGGCTCTGGAGGGATTTGGGGCCTGGTGGGGGGGGTGAAAT
CACAGCCGGCAGGCACACACCTGCTGGCCTCATGTCACTGACACGCCACCGGGAGGCCCG
GGGCTCCAGCTTTAGAACATATAAAATTAAGAGAGGAATGATCTTTGGGATAAAATAAAT
CCTGCGTGTCTGCACAACTAGTTTTGGGGATATGTGCCTGGTCCCGGGGACATCAGCTAA
AATGCTCTTCCTTTCGTTGTAAAAACAGGAAAACAACCCCCACCCCACCCCCAACCCCCA
ACAAACAAACAAATGAAAAAAAAAAAACCCACACAAAGTGTTTATTTTAATTATGCAAGG
AATGCACTGATAATTAATACACTCATTACTAACAATCAAACATTGCAGATAAAAGCTAAA
GCCGTGTGCAACCCCTCCCTCACACCCAGCTCCCCCCACCCCCAGCATTTTCACTGCTGT
TACCAGTTTTAGGCGCACGGTTCCAGATATTTTTCTGTGCTTTTATGTATGTATATAAAT
AGACCTCTAAAATATATGATTTTGTTTATTTTTTACGTAAGCTGTATCACAGTGTACATT
TCCTTCTGCTTATTTTTCTTCCCTCAGGAATCCGCTTGGAGATAATAAAGATCGACACCG
TGCCTTGGAATACACCTTAGTACCCTGTAATCTGTACGCCCTGGGGCTGCTTTAACCCCT
TCACCGCTGTCTGTCGCAAGAGCCCCAGGTCCTTACCCTGTGGGGACGGAGCGCAGGGCA
GGTGTAAGTAATTTCTCAGGAGCGGGCTCGCAAGTGTTTATGACATTATCACAAATGAAT
ATATGGATGCATCAATTAGCAAAATTAAAGAGGGACATGCCTGGACCAATGATGACAAGG
TGTTTATGAACAAAGGATCATGATTAATCCAGTTCTGCGCAAAATACTGAGGTCCGTTAA
AGACAATAGGTCTCGGCTGTTTCATTCTTTTTAAGAGCTGTTTAATATTCCGGGGTATGT
ATGCACCATTGTTGATTAGACCCTCTTCTATTGTTGAAAATCCCAGCTGTGAGCGTGCTG
GGGGCGGAGAATGTGTCCAGATACAATCTCTGGTCAAACTCCTGGTCGTCTGGGTGGGGG
GTCACAGGTTCATGGGTGCTTGTTATATCATTTAAGAAAATAAATGAAAGGGAATCCATG
AAATAAAAGTGGCCCTTGCACAAATAAATGAGCAGGACAGGAACTGAGGTTTTAATTAAT
GTGATTGTGCTCAACTGATACCCGCTAAAAAAAATATCTAAGCCGTTCCAGTGTTTTCTT
ATTGCTAATGGCCCCACAATGAGCATTTTTATAGGTAAATCTGTAAACACGTCCCTAGTT
ATTTCTTTATCCCAGCTTCTTGGAGGTGGGGTAGCTGGGTTAAATGGTTTTGCAAAGTTT
ATTTTCATTGATCTTTCTAAAATGCCATTTTGACCTTGTCACTGTCTTGCTTAAATCCTC
CCTCTGACTTCCTGGAGCTTCTGGGATGTGGTCCAAGAGCCTTAGCCGGGCACCTAAGAC
CCTTCAGGGTCTGGCTGGAAGCTTCCCAGCATCATCGCCCCTGCCCCTTGCCCCCACTGG
GCGCACTGGGCCCCGGAAGAGCCGCCTGTTCCTGTCTGTGTGCCCTGCCTTTTTACACCT
GGGGCCTTTGGCTGGGGCTTCCCAAGCAGCTTCTCCTGAGCCTTTAAAACCAGGCTTTGA
AACGTACCCCACGGTGAACTCCCCCTGACACCTTGTTCAAAAGTCCAGCGAAGCACAGTC
CCCATGAATGTGATGCCTCATTGACACATTTTCCTAGTTCAAAACAAAAATGTTTTGCCA
CTTTTCTAGAATTTAAGAAAGCGGCCACATGTTAATAATCACCCCCTTTCCTTTGTCCCT
TTCCAGTGCCCTGGGCTCCTGGGTCACCTGGTTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved