Canis_familiaris Locus Mono:111:SNORD59
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:111:SNORD59
Canis_familiaris
Mono:111:SNORD59
17
SNORD59
1001..1075
2075
ATCTGGGAGCATCACTGACACAGCAAGATTACAGGAAGAATTGACTCCAGGGTACTCTG
GCAGTTCCAAGTCGGTGGTGTAGTCATCAGAATTGCAAGATAAGGAAGATCTGGGAACTC
TTATACACTACTGAGTAGAGAATAAATTGGTACAATTACATCGGAAGACAATTTAGCAAT
ATCTATTAAAACTAAAGAGGCCCTTTTCTTACATTTAACAATTCCACTTCTCTCTATATA
TATCCAAGAAACTCTCCCTTAAATGCATAAGGAGACATTTAAATGAATATTCATTGAAGC
ATCATGTATAACAGGAAAATAATTGGAAACAGCCTAAATGTTCATCAACCTGAGAGTGGT
TCAGTAAATTGTATGATCACACAGTGGAATACTATATTGTAGTTAAAATAAATGAACTAG
AACTAGAGCTATAACATACATCAATCTAAAAAAATAGAATATCTAGTGAAAACAAGAAAG
TGGCAGGAGATATGTAAAGCATGCTACCATTTATGTTAGCTTCAGACCCATGAAACAATA
GTCCACATTTCTAAGTGTGATAAACATTTTAAAATATTAATTGTAATAATAACTCCAAAT
TCAGGATAGTTGTTACCTCTGCTGAAGAAGGAGAATGACAGAGTATGTAGATGCCTTTAG
CCAAATCTGTGTCCCCTCTTAAAAGTGGATCTGAAACACATATGGCAAAAAGCAAATATT
TGATAAAATTTGGTGGGAAAGGAGAGTTCATATTATTATTTCCTATATGCTGTAGGCTCG
AAATATTTCATTTAAAAGTATATAGGGGCCTTCAATCCTGGAATTCTGGGATTTTTTTCT
TGGTGCAGAAATTTCTTTATTCCCCCTTTTCTCATGTTGAAACTCCATCCATTTTTTGAT
ATTTAATTCAAGTCTCACTACCTTATTGAGAATTTCTGTGGCAATCTTGTTAGTCCATGC
TATGCTCCATAAAGTTCTGTAGGTCTAGAAGGTACTCTTGTATTCTATGATGATTTTATC
AAAATGACTTTTGTTTTTCTGAGTATGCTGAAGCCACATATTAAGTATTGAGAAGGAGTA
GAAAAAAAATAAAGTTCCTTTGTACACTATGTTTGTATGACCAGAATTCTTTCATTTTGT
TGTTTAAATATATATTGCCTTGCATTAATATTTGGTTTATTGAACATAAATTTTGATTCT
CTAATTATATTGTAAGAGCCTTAAGAGCAGGGACAATGTCTTGAACTTTTAAAATTCTTC
CCCAGTGTCCAGTGGAACCTAACCAAATACTTATTAAAGAAAAATGACATATAAACCAAT
AATTATTATCCTTCCTACAAAACATTTATATAGAATGTTGAAAATACTAGTTGGAGCTAC
ATTTGCTTTTATTTTCCCAGAGAGAGAATAGTAATGAACTGTGAAATGACCAACACTCAG
GCAGCAGAAGGAGAAAAAGAAGAAATAATGGTTTTGTATATTACACATTCTGGATAATCA
GCTCTTGAATGATTAAGTGTAGAAAATCTCTTATGAGTAAAAGCAGATTTTAAAAATATA
TTTTATGACTGTGGACTTGTTTTATAGATCATTTCCAGTTTTCAGATGATTCCAGGCCAA
ACTTACAAATTATTTTGGAAAAACGTTTCCTCTTACGATATGCTAGATAGCCATGTACAA
TATACCTTGTTGTCATTCTGCCTTCATTCCAATATTTATTGGACTACATGTAGGAATGGT
GACCCAGGGAAACTAAAACACAAAAAAGTGTTCCATCTGTAGAATCAGGAAAGAGTGTTG
AAGAAAAACTAATTACTTTGAATTTTATTTACCCTTAGTACCTCTTGTAAAAAGTGTTTG
GTGGACAGCCCTGGTGTCTCAGCGGTTTAGCGCCGCCTTTGGCCCAGGATGGGATCTTGG
GGGCCCGGGTCAAGTCCCATGTCAGGCTCCCTTCTCCCTCTGCCTGTGTCTCTGCCTCTC
TCTCTCTCTGTCTCTCATGCATAAATAAATAAATAAAATCTTAAAAAGAAAAAAAGTGTT
TGGTACTTGAGGCAACCACATTTGAAATCTCAGAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved