Canis_familiaris Locus Mono:120:SNORA42
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:120:SNORA42
Canis_familiaris
Mono:120:SNORA42
2
SNORA42
1001..1137
2137
GATCAAATCGAATTCCAGATTGTACCAGAGGTGCCATATGTTTCAATAATAGGAATCAT
GGGCAGATGAGATGTTGACAGGGACATTTTAAGGTTTCAAAACTCTGAGCAGGCCATTGC
AGCTTGATACAGAGATAAAGATCAAAGATGGACTCCATTAACCAATCAGATGTGTTGAGG
ACACTAAAAAATGTAAACATTAGCCAAGTTGGGGTGAAGATCCCTCCTTGACAGATTATG
TTTCTTATCATGATGAAATTGATTCCTGGCTAGTGTGCATTTAAGAAGTTCAACAGTTAC
ATTTTTATTTTTAACTATAATGGTTTATTGTTATATTACCCTTAATTTTGAGACAATAAT
GCTTGTTTTACTTGTTTGTTTTGAGAAATTTTATTTCCTCATTGTTACAGGAAGTTCAAT
TTTAATTTCTTCATCAACATTGTAACTGATCTATTGTAATTAATTCAAACAAGCATAAAA
GAATTGTCAGATCCTCTTGGAGTTAGGAAAAATAGACCTATTTTCTTCTTTTCATGGCTC
TGGTTGTAAAATAAGCTGTGATTATACCAGAATATTTTATTTCAGTATTTATGCTGAAAA
AACATCGATCTACACAAAAGTAAAGTGAACAGGGATCCCTGGGTAGCTCAGCGGTTTAGC
ACCTGCCTTCAGCCTGGGCGTGATCCTAGAGTCCCAGGATCAAGTCCCACATTGGGCTCC
CTGCATGGAATCTACTTCTCTCTCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCTCTCTC
TCTCTGTGTCTCTCATGAATAAATATATAAAATCTTTTAAAAAAAGTAAAGTAAACAATA
AAATGAACTTTCATGTGCCCATCATCCAGATTCAGCAGATCATGAAGTTGTCACATTTGT
AGAAATGCTTTTAAAAGCCAGTGCAAAAAAAAAAAAAAAACAAAAATAAAAATAAATAAA
TAAATAAATAAATAAATAAATAAATAAAAGCCAGTGCAAGAGAATAGTGATGGATTGATG
GCAGGCCTTTCTCTGTTGGCCCCTCATACTATATCAATGCCAGAGGAGCGTGCAGCCCTG
AACCACTGCCCAGCCTCCTCACTGGTGGGCTGTGAGCACTGAAGGCGGCTATACAGGGGT
AAAAAAAATTTTTTTTAATTAAAAAATAGTAAGCCAATACCTACATTTAGCTGTATATTT
AGCAGTGCAAACTGGTCCTTTGAGCAGCTACCTCTAAGGTCCAAGGACACTAGAGCTCTG
TGTAATGCCAGAGCTATTTTTTTCCTAGCACACACCTCAGGGTGGATATTTCTACTTCAG
ATTTAAGCTTTTCTTTATTTTTATGCTTCATTGGTTCTGTGGTTTGTTGTGTTTCTTTTT
TTTTTTTTTAAAGACTTATTTATTTTATTTAAGACGGAGAGAGATGGTGGGAGGTGGGGG
GATGGGGTTGGAGCAGAAGGAGAGAGAGTCCTAAGCAGGCTCTGGTGGGTGCAGAGCCAT
AGCTAGAGGCAAGGCTTGATCTCCTGACCTCAGATCAGGACCTGAACCCAAATCAAGATT
TGGAGGTTTATCCAGCTGCACCACCCCACCCCCGTTTGTGGGACTTTAAAAATTGTTACA
TAAATCGTACACACACATTCTATTTCATCAAACAGTACATGGGAGTTGTTACTATTTTTT
TTTCTTTTTTGAAAGATCTGTCTCTTCTTAACTCTGAGGTGACCACTGTTCATGTGAACT
AGTTGATTTGAATCATTCACAGCTTATCTTCAAGGCCACACAATCACGTGCAAATATCCT
GTGCTAGTTAATAAGCCCTTGTGTCTTAGCTCCAGCCTACTCCCTGTTTTGTGATGGTGG
GATTGTAACGTTGCTCTCTGGCTTCCTGTTAGGATCCTAGTTGTTTTCCATTTGTTAGCC
CACTGGCTGAGGATTGCTCACACCACCCCCAAAAGCTTTTTCACCCCCACAGTTGTACCT
GTGGCCCCAGGCAGTGGCTGAATCAGGCTTGCAGTTTTTTCAACAGTTGCAGAACCAGAT
TCATCACACACTCTCACTTAGAGATCTTCAAGTTCAATTTTAGGTACCTAGTTAGCCCAT
TCTAGTTAACCGACTGATACCTAGTTCATTGTTATTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved