Canis_familiaris Locus Mono:45:SNORA20
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:45:SNORA20
Canis_familiaris
Mono:45:SNORA20
33
SNORA20
1001..1130
2130
GAAACAAAAGCAAAAACGGACTATTGGGACTTCATCAGGATAGAATAGCTTCTGCACAG
CAAAGGAAACAGTCAACAAAACTAAAAGACAACCTACAGAATGATAGAAGGTATTTGCAA
ATTATCTTATTACCTAAAGGGCTAGAATCCAAGATCTATAAAGAACTTATCAAACTCAAC
ACTCAAGAAACAAATAATCCAGTCAAGAAATGGGAGAAGACATGAGCTGACACTTCTCCA
AAGAAGAGTTACACATGACCAACAGATACATGAAAAAATGCTCAACATCACTTGGCATCA
GGGAAATACAAATCAAAAGCACAATGAGATACCACTTTATACCAGTCAGGATGACTAAAA
TTAACAAGATAGGAAAGAACAAATATTGGCAAGGATGCAAGGAAAGGCCAACCAACATCT
GCTGTTTTTCTCCATGTACTTTTTGATTTCTTCTTTAATTTCTTTGTTGTTCCATTCCTT
ATTTACAAACATATGTAACCTTACTGTATTTATGCTATTTTTCAGACTTTTCTTGCAGTT
TATTTCTAGTTTCTAGTTGCATAAAGTTGTAGTCAGAAAAGATGTACGATTTAACTTCCA
TATTTTTTAATTTGTTGAAATTTATTTCATTGTCTAATATGTGATCTATTATGGAGAATG
TACCATCCGCACTTGAAAAGAATGTGTATTCTGCTATTTTAGGGTGGAATTTTCTGACTA
TATTTGCTGGATCCATCTAATCCAGTGTGTCATTCAAAGCTACTGTTTCCTTGTTGATTT
TTGGTTTGGATGATCTGTCCATTGATGTGAGTTGTTAAAGTCCTCTACTATTATTATTGT
TTTATTATCAATTAGTTCCTTTGTGTTAGCCATTAACTGTTTTATGTATTTGGGTGTTCA
CATTTTGAGTGCATATATTTACAATTGTTATATCTTACTAGATTGTCCCCTTATTATTAT
ATAGTGTCCTTTTTTGTTTCTTGTTAGAGTCTATTTTGTCCCTTCCCATTGATTGCTGCT
CTAGTCTTTTAGTGATATAAGCAGTTATATACATGAGAGAGAACAGTATTAGGGTGTTGC
AAAAGGAGATGGGAGTAACCATTTCATCTCTTCTGTGAAGTCCAGACATTGCTTTAATGT
CTGAATCATGCAAGCAGGATTCAACCAAGGTGCTTATGGTGAATATAGACTTACTTTATA
AAAACATTGATTTAAGAATTTTACTTTACTTTTTAAAATAGCACTAAATCTCATACATCT
GCATCAATTATCTTATGTGAGGCAAATGATTTCATGTGTCATAAGATGGAGTGCTCTTTA
CATGATGCTCTTTGTGTTTTGAAGAGAGTTTTGGGGTCAAAATCCGTGGTTCCAGGTGGG
ATACTATAGAAGCAGCCCCTTCCATATACCTTTAGAACTACAAAACCAGATGAGGCCTCA
GAAACAGCTTGCTATATCAGAGTTTGCAGGATCTCTTCTTATTTTTTTCTAACACACTGG
CAGTTAATGCTGCCCAAAATTCCACAGACCTAGTTGCAAAGTTAAGAGCTTTCCATAATG
AGGGACAAGGTAACCCAGAACACAAATTTCGTAAATGAATTGGTCTTGATTTCATCAATG
GTAAACCTCAAGACAACAAACAAGCAGGGGTATTTGAACCAACCACGGTGAAAGTTAAGA
GTTTAAAATTTGTGACAGAAGCTTCAATTTCTATTCTTCAAATTGATGATCTTACCAAAT
TACACCCAGAAAGCAAAGATGATAAGCATGGAGGTTATGAAAATGCTGTTCACTCAGGAG
TCCTTGATGACTGATCTGATTTCTCTTTTATTTGTAATAATATTAGATGCAATTATCTTG
TACCTTGAGTATCACATATTAAAAATAATGGGCTGTCAAAAAAGTCTAGTTTGTCCGTTA
TTAGTATTGGTACCCCAGCTTTCTTTTGACATACATCTGCATGATAAATGTAAATCTCCA
TTCCTTTACTTTCAATCTACATGTGTCTTGAGGTCTAAAATGAGTCTCTTGTAGGCAGCA
TATAGATGGGTCTTGTTTTTCTGTCCATTCCATCACCCATGTCATTTGATTGGTGAGGTT
AGTCCATTAACATTGGAAGTAATTATTAATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved