Canis_familiaris Locus Poly:12:SNORD74
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:12:SNORD74
Canis_familiaris
Poly:12:SNORD74
7
SNORD74, SNORD75, SNORD24, SNORD77, SNORD44, SNORD78, SNORD79, SNORD47, SNORD81
1001..1080, 1492..1553, 1704..1785, 1996..2064, 2368..2429, 2673..2737, 3015..3089, 3911..3988, 4147..4223
5223
AGGGCAGGGCACCGGGAAGGGGGCGGCGCCCGGGACCCCGTCCAGGCGGCAAGCGGAGG
CGGGCGCGGAGCTGCCCAGAGGTGGGTGTGTGTGTCTGGGTGTGTCCGGGCTGCGGTGGG
GGAGGGGGCCGCCCATCCCGGGGTCCTGAGGGAGGGGCCCGGCGAGGGGGCGGGTCCGGC
AGCTCAGCCCGGCCCGGGGCCAAGGGGGTGGAAGGTCTCCCGTGCCTTGAGGGTGGGGTG
AAGGGGAGTGGCTGAACGCCCCAGGAGCGGGCTGCGGCGGAGCCCGGACGAGGCGGCCCC
GGGGCAGGGCAGCGGGACCGGAGTGCGGGGCCCGAGCCCAGGCAAGGAGCAGCACCTACC
TCCGGGGGTGGAAATGGGCCGGAATGGGCCGGAACACCGTCCAGGAAGTGAAACCCCCCA
CCCCCTCCCCCGGAGCGGGCGACGTGCCGGAAGGAAATCACTCACCCTTACACCGCCCCC
CTCCCCCTCCCCCAGCGCTTTCCGTCCCTCGCGCCCCCTCCCCTCTCTTCCTTCTCAGGC
GGCCGGAGGGCGGGAGCATGGAGTCACGCGGGCGGTCGCGTCGCCGCCCACAACGGCGAG
GCGGGGCGGGGCCAAAGGGGAGGTGTGGCTGGAGGAGGAGGAAGAGCTGAAGGGAGGAGA
TGGGGAGGAGCTGAAGCCGGCGCTGGCGGAGACGGTGCGTCATGACGTCAGGAGAAGCGT
CCTTATATACCGGCGCTTGGACGCCATCTCGGTCTTTTGAGGCTAGGAGTCGGCTTTGGG
TACGTATGTGTTCTTTTTGTTTAATAGCTTCTTGGCTATAAAAGCCCCCCCCCCCCCCAA
GCTCTTGGCAATTGAAGGCACCTTAACCTGGTACTTTTAGGCTGGTCGCGAGCCTTTGCA
GGAGTCACAAGATGAAGATGGTAAACGATTGCGCGTTGGGTGCGGCCCAGACTCAACGAC
GCGGGTTGTTGGGGCTGAATGCGAAAAACCCGTGGGCTCGCGCTTCCTGCCTGTGATGAA
GCCTGTGTTGGTAGGGACATCTGAGACTGTTGATGAATGCCAACGGCTCTGATGGCGGCG
CTTGCCGGGTCCCCGAGTGGGCCTTCGTTAGTGGCCTCGGCCCGGGCCTCCTGCGGCCTC
GCCGGGGAAGGCGGGCGGTGGCGCTAGTCCACGTGGTTCTCAGCGGCTGCGGTCCGCGGT
GCGCCGTTAACGTCAGTGCCTCCCAGCCTTTGTGCGGTGCTTTCTGTCTAGGCTGTTCAG
TGCATGCACCCTTTATAGTCCTGAAATTATGGTTGAACGACCTGATTCAAAACGACATGC
TTAGGCTTCAACTTAGAACAAAATGACTTACCTTAAAATCCTAACCTTTTTTTTCTAGGA
ATGGTGCTAGGCGCGAGTGCAGTGCGGCTTTTGATGGCTCCTGATGGAAAAGGTAAGAAA
CGGGTAGATGCAGTGGTAGAAATCTGATCTGCTTGGAGGTGGTATTTTGTTTAGCCTGTG
ATGGTTTAAGAGTAGTGGACAGAAGGGATTTCTGAAAAGTTTTACTCTGAGGCTGAAATA
CCCAGAACGTTGATAATTAACTTGGCTGCGCCGCGTGTTTCATTGGATTTTCTTTGTCTG
TTTTCTAGTTCTGTGCCAAAGGGGTGGAAGTGGCTGCCAAGGTAAGTTAACAGATTTTCG
CACACGGGGAGCTTGGCTTGAAAGTGCTGCAATGATGACATTTTATTTGCTACTCTTGAC
TGTGAGAATGACGAGAATTATTACCACCGTTAAACTAACTGAGGCACCCAAAATGGTGAT
TTAAAGAATTTAGAGATTACAGCTAAGTTTACATGAAGCTGTTTCTTCCTAGATCCAAAG
CTCAAGTTTCACATCCTAGCCATGGGCAAACAGGTGAGAAACCTCTTAAGTAGTCTATAA
TTTACCCGGTACTTTGCTGCTGTGAACTTCTGTATTCTGGTATTTGTATTGAATGCTTGG
GGAACCTGAAAAACAGATACTTATGATGGTTGCATAGTTCAGCAGATTGGATCATGAAGA
GAGACACCATTTGTCTGATGTATCTGAGTGGATAGTAAAACTGGGTTTGGTATGAAATAG
CACAAGCAAAATGCGACTAAACCAATTTCTCTACTTTTTCATAGGCATTCAACAGAATTA
GCTGGAAGTTGAAAGGGTGAGTAAAATTATAGTTCAACTAAACATTGGTAACAGGGCAAA
CATGACAAAGCATGCCACTGATGGCTTTTCAGAGTCTTCTGCACAGAAAGCATTCCTACC
ATGGAATGCTTGGATTGCTTACTGCATTAAGTGGCCAGATCCTTGTCCTGTTACCGTGAG
TTAGGACTCTGTCATTTGTAAAAAGCAGCCTGTATGATGATAAGCAAATACTGACTGAAC
ATGAAGGTCTTAATTAGCTCTACCTGACATCAGGCATTTTTTGGATTTGTGGGGAGGAAA
TTCATCTTTTGCCCTTTGCTAACTATATTTATTTTTTAGGTGAACTTGAGCCTTTGACCT
GTCTGCACCAACTATTTTTGGGGTAAGTGTTAAACATCTGAGTATGTCCAGTATTTACCG
TGAAAGCTGAAATAGAATGCTAAACTACTAAGTTACTAGTTTTCTACATCTGGTTAGTAA
ATGCATCCTGAGGATGCTTTGAGAACGGGGTTTTTGAAATGATGTTGATCAAATGTCTGA
CCTGAAATGACCATGTAGACAAATTTAACACTGAAGAACCCTGTGACAAAAACTTTAGAA
AAATTCAGGATAATTAACATTTTAATGAAATGTCTTGTTTCCTTTCTAGCTTACAGACCA
CTATCATGGATGGCTTGCTTGGGGGTAAGACCTAAAAACTCTGGTTTCCGAACTCGGGTC
TGTATTTCTGTAATGTGCTTTCTGGGTATTGTGAAGTGTGTCTAAAATATTTTTTGTTAG
GTGCTGATTTTAAAGACCTCGTATAAAGGTATGTATTCTATTATTACTACTCCTACTTGA
TTACTAAGTAAAATGCTGTTAGTGATGATTTTTGAAATAGATGGGAATCTCTCTGAAAAA
GAGTGAAGATTTTTAAAAACTGAAACAGTATTGGGAAAGCTTGAAAAACCTACTGTTAAT
ATTACTTATTAATAAATTTGACTAAATTTCTGCAGGTGTGAAGAGTTTTGAGGCCAGCTT
ACAAGACCTGGGAACACAGGAGTTTAATAAGTAAGCCATGGTATGGAAATCTCAAGTTTG
GTTTCTACATGTAGTGACTTAAAGCTGATACGATGATGAAGCCATAGTTCAGCTGACTAG
CAGTGATGAGCAAAATTGTCTTTCGCTCCTATCTGACGTATCGGCTGCAGCAATCCTATC
CATAGCTGTGAAAAGGAAAATTAGTCATTCTACCACAGAAGATACGGGTTTTGAATACTA
TAGTGGCTCATGCACAAATGTTCTGATTTTAAGGATTCACAACTTGAGAAACATCGTTTT
TGCAAGGTATTTTATGGCATTTGAATGCCAGAGTGAGTTAATATCATTTTCAAGAGCAGT
TTCAGTATTCCTAGCAAAATTGAATGTAGGATTTCTAAATACTGTCTTCACACCTCACTG
TCCACATTCACCAGAGTGAGGATTTTGCTACAATTATGAATCTATAATAGACAATTACCA
CCCACATCCATAGTTTACATTAGGATTACTCGTAGTGTTCTATGATAAGGGTTTGAACAG
CATATACTTAAACTATTAATGTGTGGAATAGGTTTGCCGCTCTAGATGTTCTTAGTTACA
AATGGGGAAAATTAAGTAGTATGAATTTTAAATAAAAGGCCTTTTTTCCTTTTTCAAACA
GGCAGACCAGTCAACCTGAAGATTTAGAGAGAGGTAAGTTGGTTTCTCATCCCTCTGATA
GATTAGAATGTAACCAGTGATGTAGTGATTCTGCCAAATGAAATAGAATGATATCACTCA
TAAAACCGTTCCATTTTGATTCTGAGGTTACTTCATTAGCAAGCATCACATAGGGTGTGG
GTTTTAAAACCAAGATTAACCTGCAATCCTTGCTTGTAGGGCATTTACAAGAGCAGCAAT
GCAGTTATGAGAACATCTTACCAGCTAAAGGGTAAGGCTTGAAAATATCAGTACTTTTGT
CCTATTCCAGAATACATGATGATCTCATTGCAACTTGAACTCTCTCACTGATCATTTGAT
GATTTTAAAAGATCTGATATTCTGTGTACTCAAAATATTAGAATTGAAACTTAGAAAGAA
ATGTGAATAAAAATGGCTTCTTTGTCCTTGCAGGTACCCGAATGGATGCTCATGGGATAG
AAGATCATACTTTCAATTTCAATAAATTTTTATAAACCATCTGTTCAACTGTGCTTATTA
TTTCAATTTCATGGGATGGAGGGGAAATAGGACATCTTTGTAGTTTAAGACCCTGTGACC
TTAGTTTTTTTTTTTTTTTTTTTCTTAACAAAATGAGACCTTTCCACATAATTTAGAAAA
TGTCTTGGGCTTGAAAATACAAATTTGCAGAGGAATATACTATAGCCTTTTCGTTTAAAA
CACTTGATTTAGAATAGTGATATGATTGAAAGATGAGCTATATATTTTGCAGAAATATTC
TAGAGCTGAATGGAATCTCTGTCCAAGAAATACTTGATATTAAGCACCATAATGATGGCT
CTTTTGATAGTGTCCATACATGGTATAATGGAAGCAATTCAGTTATCTTCTCCCCATAAC
ATAATTGAAAGCCCCCAAATTGTGTAGATTATAAGAATGTAGGGAGTACTGTGGTTCTAC
CAATATCCTTTATAAAGTAGGTATTTTGTAGGAGTGCTAATTTGGTAAATGAAAACTGGG
GTTTTGGCCATTAATGAATGCATACAGAAGGTAACAAGCCTCATAAAAACATGCCAACCA
AATTGCAGCTCACATTTAATGCTTAAAGGGGGTGGGGTAGAACATTTGGGTTTGCAATTT
ATCTTAGGACTTCACCTACTTAGGATAGTTTTAAGACCGGATACTCCAAAATCATTCTGG
ACTTTTGTGCTAAAGGATTTTTTTTTTTTTTTCTAAAGGATTTTTAAGACCCAGGCAGAG
GGAGAAGCAGGCTCCCTGTGAGGAGCCTAATGGGCTTGATCCCAGGACCCCTGGATTTGA
GCCAAATGCAGACGGCCCAACCACTGAACCACCCAGGTGACCCATTCAGGATTAAATGCT
CACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved