Canis_familiaris Locus Poly:4:SNORND104
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:4:SNORND104
Canis_familiaris
Poly:4:SNORND104
9
SNORA76
1271..1404
2404
GCTCAGGCCGAAATCCCCAGGTTCTGCCATCGGGCCCACATCAGGTTCCCCGCAGGGGC
CTGCTTCTCCCTCGGCCTATGTCTCTGCCTCTCTGTGTGGCTCTCATGAATAAATAAATA
AAATCTTTAAAAAATGATTTGGGGGCGCCTGGGTGGCTCAGTGGCTGCCGTTGGCTCAGG
TCATGATCCCAGGGTCCTGGGTTCCAGCCCAGCATTGTGCTCCCTGCTCAGCAAGGGAGT
CTGCTGCTTCTCCTCTCCCTCGGCCTGCTGCTCCCCCCTACTTGTACTCTTGTCAAATTA
GTAAATAACCTTTAAAAAAGATAAACACAACTGTTTACCACTCAGAATGCACCAGGCAAC
TGACGTTACTTAATCGTCATAACTTTTTTTGATATCATTTTCCTCAAACTGAGGATCGTA
TCACAAATTCGTCACAAAGACAGGATTTGGTTGCACACCCTCTACTTTCAAAAACAGGCT
CTTTTTTTTACCCAAACAGGTTTTCAATTCAGGAACGAGGTTAGGCTGCCACCCAGGTAC
GCTCAGCTCCTCGCCTAGCTCCTGGCACGGAACATCTCAAACAAGTGAGCGCCAGCTGCG
TCCCGTTTGCAAACTTCCCTTCGGTGTACCGTACAGAGACACGCTAATTACGAGCACCCG
ATTTACGCACGGAAAGAAATCCACAATTTAGGACACAGCGCGCCTTGCGGCCCTTCTTTC
ACGCCCGTCTCTATGGTTGGCAGGTGACCACTCTACACTCTGGAGGACTCAGCGAGGACA
GCCTCTCCTGAGGCCCCTTTACCAGCACGTGACCGGAAGTCTGGCTTGCTATTGGCTAGA
GCCGGTAGAGCCCGCCCAACCGCCTCCTGTCAGTTCCTTTAAGTAGAAGACAGAGGCCCC
CGCTCGGCCTTTCGGGGACTGTGACGCCGGACCGGCCAGGTGCGTTTGTGTTGGGCCCCG
GCGGGCCGGCCCGCAGCCTGGTGGGTCGCGGGGGGCGGCCTGCAGTGATGACATTCCAGA
AAAATGCACGTGTTAGACTGCTGACGCGGGTGATGCGAACTACAGTCTGAGTCGGGCCTC
CGCGGCGGCGGGCAGGAGACGGGCAGGCCCGCGGGCGCGCAGCCGCTAACCACCGCTCTC
GTTCTTGCAGGTTCCGGCTGGGCCGAGGACGTCGGAGCTTCCTGCCCTCCTCCCCGCCCA
CCTTTACCCCGAAGCCTCGCAATAAAATGGTTTGATCCAGCGCTGGTGTTAAGCGTCTTC
GTCGTCCCGACGCGCTGCCTTTGAGCCCCCGCCGCGCCTGCGCGTGGCGCCGGGGGTCAG
GCTGCAGCGCCAGAGCACGCGCTTGCGCATAACTGGGGCCGCCCGGTTCCCCCGCCGGCG
GCCCTTTTAACCGCGAGCGACACGGCGGCACCTGCAGGGGACGCGAGCGTGGGGCGGGGG
CGATTTGCGACTCCAGCCTCAGCCCTTGAAGCCGAGGCTGAAACGCCCCGGGCAGACGCG
GCGATCCTCTAGGTCCCGGTACTCAGGGCCCTGCATGTTTCCTGGAAGTCCTGGCCTCCG
TGGTCTTCGAGACCTGCAGGCTAACCGCGGCGTGGGTGGCCTCTGGAGGGAGGGAGGGAG
GGGGCTGTCCGTGAGCAGCTGGAAGGGCCGCTGTATACTTGACGGGAACTGGTTTCAGTC
TTGAATGCTTCCATGAAGTTACCTCACCTGGTTAAGGTGTAGCAGCGACCCACTTCGAGA
AACTACAATTTAGGGTCAACTGCTTACCTGGATACTGTGCCAAGCATGGGAATAAAAGCT
TTGCAGTTTAGCCCAGTTAGCCTAAACAAGGTAGTTCAGATGAAGTAGATCTTATGCATT
GCCGGGCACATCAGGCACCTAAGTAAATGCACAGTCCTTCCCGGTCCGGATGATTGGTGG
TGGTCTCCTCTGGGTTTGGGTGAAATATGCAACTTCGAGTACCAGGCAGCTCTGTTGACG
GGCAAGGATGCCCAAGTGCAGTGTTTAACCTGCTTTGGCATGTAATAACTGGGGCATCCG
AAGTTAACAGGATTACTAGGCTATTGAGGGTGTAAAATCCAGCACAGAAACAAAGACGGT
CGCCCTCAGGTTTTTAAAATCCTTTGAAGATCACACCTACCTCCTAATATTAGAAAACCC
ATCTGGTGATCATACCAGGAAATGGAAGCTGCTTTGGCAGCTTGAGTGCCCAAGTGATCT
GTACACCTTGTTTATCCTCTCCCTATTAATCTAAAAAGGAGGATTCAGCAAAAATAACTT
AGATGCTTATCTAGTATTTGACATTGAGATATTTATTTTGTGAAACAAAGCAAGCGATTG
TAAATCCCCACATACTATTTGAGTGCAATAGGGTAGTCGTGTGTAATCTCTTTACACAGT
AGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved