Canis_familiaris Locus Mono:50:SNORD29
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:50:SNORD29
Canis_familiaris
Mono:50:SNORD29
8
SNORD29
1001..1061
2061
GCAAAAAAACTAAATGTCTGTGCCACCTCCCCTTAATTTTCATATGCTGACATCCTAAT
CCCCAGTGTGATGGGATTTGTTGGTGAGCCCTTTGGGAGGTGATTAGGTCATGAGGGTAG
AGCTCTCATGAATGGGATTAGTGCCCTTATGAAAGAGAAACCAGAGAGCTCCTGGCCATC
TTTCCACCACGTGAGAATAGAGAAAGGTAAGTAGTCTGTAACCTGGAAGAGGGCTTCACA
GAACCCAACCATGCTGATCCCCTGATCTCTGATATCCCAGTCCCCAGAACTGTGAAAAAT
CCATTTCCATTACTTCTAAGCCACCCAATCTGTGGCTCTCTGTAGTAGCAGCCCTAATGG
ACTAACATAATGCCCTACCCTAGAGAACCTCAGATTCACTGATGATAAGATCACATTTGG
AGTCTGGCAGAGAACCTAACAGGACAGAGTGTTTAAGAGCTACACTTCTTCTCAATAGGA
TTGTGGATCAAGGTATCCTAGAGATGGTGAGTTTTCACTGATGAGGGCAGGACAAGTTCT
TGGGGTGGAAACAGGAAGAAGGAGAGCTGTCTTTCAAGGCAACTTAAAACGAACTGCTTT
TTAATCTTCCAAATAACTGTCAGGTTAGAAAGATGCTGTTTATAGTCAAAATGTCTATTT
TTTTAGCCCCTAGTGGTGATGAAGACTATGTTTATGTGATTAACAGCAGAACTTGCATAT
AATATCCCAAGCCCATGCTCCTGTTTTCATTTCTATGGGGACAAGTGGGCAATATCTTGG
TCCAGTTATCCAAAGAGGTCACAGTACTCATTCCTTTACCTCTTCTCTGTGGATAGGTCT
AAACTGTCATTGGACAGAAACACACATGTGAAATATTCAGGGACCAATGTCTGCCTCTCC
CCTATTCCTCCATTTTTCTCTTTTTCTCAGAGTTTACACAATGAGCAGATGAGAAGAGTG
TGAGGCAACATGTTTGTGAGTCTCCTTTGAAATCTTTCCTTTTTCCATGATGAGTCAAAC
TAGCTCACTATGACCTTACACAATGAAATATTTTCTTGGTTATGTTGTCTTGCACCCCAG
TGCCATGGACCACTCGGCCATCAAGAGTGAGGAAGGGGAACCTTGGGCAGTAGGTGCCAA
GTGGCTGCACTTGGATGAGGGAAGACAAAGGACAAAGGCCAGGAAAGGCCAAGGTTAGAG
AAGATTTCCACTTTCAAGAGGTTTATGGCTGATTGAGTCATCTAGCATCAAGGTTTCCTC
CAAGACTCAACCTTTTCCAGAAAAGAAAAAGAAAGAAAAGGAAGAAAGAAAGATAGAAAA
GAAGGTAGGAAGGAAGGAAAGGAGGGAGAGAGGGAAAAAGGGAAAGAAAGAAAAAGAAAG
AAGAAAAAGAAAGAAAGAGAAGAAAGAAAGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA
GAAAGAAAGAAAGAAAGAAAGAAGAAAAGAAAGAAAAGGAAAAGGAAAGGAAAGGAAAGG
AAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGGAAAGG
AAAGGAAAGGAAAGGAAAAAAGAAAGAAAAAAAAGAAAAGAAAAGAAAAGAAAAGAAAAG
AAAAGAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGA
AAAATTACCAGTGGGAATTCAAAATAAATCTCAGGCAAGTGGAAAACAGTACTCAGGCAC
TTAGATTCAAATCAAGCACGAGATGCATGGTTTTATTTTCTATAAGTAGGTGGAAAGGAG
AATTCTCAAAATGTTTTCTTACAGAACTCTTCAAATATACCTAAACATGGAGAGGAAAGG
GTAAAATTCCACATTAGTCCATCACTTAGTTTCAAAAATGGTCAAAATTGTATTCTTTAA
TCAGAGAGAATCAGGCAAAATCTACAGGTACATACACATGGGCATCAGGAGGTTGGAGGT
AGAAGAGTGTGGACAAAGCAACCCTGGGCTTTGGAGTGTAAGTCCTCTTCTCTTGCAGGA
GGTACAAGCAGGAGCCAGTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved