Canis_familiaris Locus Mono:5:SNORD22
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:5:SNORD22
Canis_familiaris
Mono:5:SNORD22
X
SNORD22
1001..1121
2121
AGCTTATATCGCTTCGAAAAAGCGTGTTTCGCTATGTAACATTAGTAGGAGGAAACGTG
CATAGTTGTGCCTTTAAAAAAAAAGTCATTGATATAGTCCTCAATAATTACACGCTCATA
GTCTGTATATGTATCTTCTGTCGTTATTTGAGTGATTTCTGTTTCCTCTGAAAATCATTT
CATCTAGGTTTCATTTTCAAAATGTTTTACCTATTTTAACTTTATTCAATTTTAATTTAA
AAATTATTCTTTTTTAAAACATTTTTTAGAGAGAGAGCTCAAGCAGTGGGGGGAGGGACG
GAGGGAAAGAGAGAGAATATCCCGCTGAGCACGGAGCCCAATCCTGCATATTCCACATCC
TAAATTCAAAGGCATCCCCTTTCATCCATATTCTATACCGTTGCCGGAGAATACTTTACA
TACCCCTGATGCATTTCTAAAATAATTTTCTTTTTACTTTTCTGATTGCCTTCTTTTCTT
TCCCGTGGGGAAAATACCGGTCTTTTCTAGGGTGTACTTTGTATTTCCCAGTTGCTTACA
AATCCTATTACCAGTAATAGAGGGAATTCTTCATCTTTGGAATACCGACGTAGTCTTCGA
CACTAGGCCATTCTGCATGGAGACCGTCTCAGTCTGCTCAGGCTGCTCTAATGAAATACC
ACAGACTTTTGGTGGGGGGGCAAGGGGGATCTTTAACAGTACACATTTGTTTCTGACTGT
TAGGCGGGCTGGAGAATGCAAGATGAAGGTGACCATGTGGGTGGGTTCTGGTGACGATTT
TTTCTGGTAGACAGATGGCCACCTCATCAACCTGTTGCCACATGGTAGAAAGAGATAGAG
GAAGCAAGCTCTCTCTTTATCTTCTTGTGGGGGGCACTAACCCCATCGTGGGGCCTGCCC
TATGGAACCTTGATCCTCTCCAAATACCCCACCCCTAACACCACCCCACTGGGGGTTAGG
GCTTCCACATAAGAATGTGGAGGACAGGGGATCCCTGGGTGGCTCAGTGGTTTAGCACCT
GCCTTTGGCTCAGGGCGTGATCCCTGGAGTGTAAAGGTGAACCCACTGGGGCTGGCTGGG
GGGAAGGAGGAAACTTGCTCCAGAAGGAACAGTCTGAGGGATCATAAGGGATTTCTAAAT
ATGGGAAAAGGGAATAAATCATTTGGTGAAGTCAACTGTACATACTTCTTTGTAGGTCTA
AAGAAAGAACAAAGCTTTTATATAACAGGAATCCAGTTCTTCAGGGACACCAAAAGGAAA
TTTTTTTAAAGTTTTTATTTATTCATGAGATACACGTGGCGGGGGGCGGGGGTGGGCAGA
GACAGGCAGAGAGAGAGAGAGAGAAGAAGAAGCAGGCTCCATGCAGGGAGCCCGATGCGG
GACTCAATCCCAGAACTCCAGGATCACCCCAAAAGGAAATTTTTACGTCATTTTTGGTGC
AACCTAGCTGGAAATTAGCATGTAATTGTTTGAGCCTTGCTGAATAAAAGTTTAACCTTC
AAAAAATAAGAAATAATAAAATAAAATAAAATAAAATAAAGTAAAATAAAATAAAATAAA
ATAATAAAATAAAATAAAATTGTTACTCGGTGCCTTAACTGTTTTGTAGAGTGCCACTCT
CGTCCTTCATGCTTGTAAAACTCAAGAAAACAAGTGGAGACTGATGTGGAAACAAAGGCA
GAAGAAAGATTAATTATTAGATTTCCTTACTACCTACAGCCTCGTTGGCATGTCCTTGAA
ACAGGCAGAGGGACCTTCCTCTAGGGATGCAGCTACCTCAATGTTAATCCTTTGCTAAGG
GCAAAAGGCCATCTTAGCCTGACCCCCAGGACCCTGTGCATCTCCTTTTAACATATTACA
ATTGCAAAAATAAATAAATAAATAAATACATACATAAATAAATACATAAATACATAAATA
ACATATTACAATTGCTTTGAAAACTTCCTTTATCTCTACTCCCTGAAAATACATGCTGGT
GATCATCCCCGAAGCAAATGACCCACCGATGTATATCTGAAGGGTCACAGGACCAACATT
TTGTTAGACGATAATAAATGACCTTTTCCCAACAATATCTAGTTCCCTCAAAGTCCTAGA
AACCTTGTTTCCAAAATTCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved