Canis_familiaris Locus Mono:17:SNORA2
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:17:SNORA2
Canis_familiaris
Mono:17:SNORA2
9
SNORA2
1001..1109
2109
GGACAAGGAAGTCTAGAGTCTCCGGAAGGAAGCAGCCTTCCAACACCTTGAATTTAGTT
CAGTGACACCCATTCTGACTTTGGGCCTCCAGAACTGTGAGATAGTAAGTTTGTGTGATT
TTAAACCATTATGCTTGTGATGTTTGGTTCCAGCAGTCATAGGAAACTCCTCTCCAGCCT
CTAAGGTAAGTGCTGTGTGGCTCCGCTGCATGCTGTTCATGGAGACTCCTGAGCTGTTGA
AGCCCAACGGGGTGCTTGTCAGAATCACCAGAGGACATTTATTTATTCATCTGTTTTTTT
TTTTTTAAGATTTTATTTATTCACGAGAGACACACACAGAGAGAGAGAGAGGCAGAGACA
CAGGCAGAGGGAGAAGCAGGCTCCATGCAGGGAGCCCAACGTGGGACTCCTGGGTCTCCG
TGGGCTGAAGGCGGTACTAAACCACTGGGCCACTGGGGCAGCCCTATTTATCTGTTAGTT
AATGTATTTATTATGGAATATTTCAATAACAGAATTGACAGATGTATAACAAACATCCAC
ATATGTTTGTCACTGGAGAAACAAAAGATTGCCAATTTAGTTTTCCTATGGCCTCAAAAA
AATGGAAAAAAATTCTTTAAAAAATGGAAAAAATTGGGATCCCTGGGTGGCGCAGCGGTT
TGGCGCCTGCCTTTGGCCCAGGGCGCGATCCTGGAGACCCGGGATCGAATCCCACGTCGG
GCTCCCGGTGCATGGAGCCTGCTTCTCCCTCTGCCTGTGTCTCTGCCTCTCTCTCTCTCT
CTGTGACTGTCATAAATAAAAAAAATAAAAATAAAATAAAGTGTGGTGATCTTTAAAAAA
AAAAAAAAAAAAGGAAAAAATTGTGTAGTAATTCCCGATATACCTACCATAAGATTCTAT
AATTTACATTGGACTCTTTATCATGCAACTGTTCATTTCTCCACCCATTTATCCACCCAT
CAACCCACCTCGTTTTTTCATGCATTTCAAAGTAAATTACATTGGCCCTGAGTCAAGGCC
GGCAGTTTGCTGAAGCTGTTGGTTTAAAGCAGGAGTCTCAAGAAATGTCTTTCTAGGGGC
ACCTGGCTACGTCAGTTGGTAGAAAATGCAACTCTGGATCCTGGGGTCCTGAGTTCAGGG
CAGCCCCATGTTGGGTGTAAAGCCTACTTAAAGGAAAACAAACAAACAAAGCTTCCCTAA
ACATTTCTGTGCAATTTTGTGTATGTGTGTGGTCCCATTTTCATTTCTCTTGGGTAAATA
CACAGGAATAGATGTACTGGGTCATAAGTAAGTTGTATGTTTATTTTTTTATTTTTATTT
TTTTAAAGATTTTATTTATTCATGAGAGACACAGAAAGAGAGAGAGGCAGAGACACAGGC
TGAGGGAGAAGCAGGCTCCACGCAGGGAGCCCGACGTGGGACTCGATTCCGGGTCTCCAG
GATCTCGCCCTGGGCCAAAGGCAGGCGCTGAACCGCTGAGCCACCCAGGGATCCCCTGTA
TGTTTAATCTTATGAAACTGTTACACATTTTCCCAAAGTTGTGCAATTTAAAAAAATTAA
TGAATTAGCTAATTAATTAATTTTTATTTTTAAAAAGATTTTATTTATTTATTTGACAGA
GAGAAAGAGAGCACAAGCAGGGCAAGCGGTAGGCAGAGGGAGAGGAAGAAGCAGGCTCCC
TGCTTTACTGACAGCACCACGCAGGCACCTTTATTTATTTATTGGTTTATCTATTTATTT
ATTTATTTATTTATTTAAAATAATCTCTGCACCGAACGTGGGGATCAAACTCATGACTCC
AAGATCAAGAGTCACGTGCTCTTCCAACTGAGCCAGCCAGGAGTGTTGTGCCATTTTAAA
CTTTCGACAAAAATGTAGAGCTTTAGTTACTCTATATCCTCTTCAACATTTGGTGTCTTC
AGTCTTGAGTTTTAGTCATTTTGTTGACAGTGTAGAAGTAGCTCATTGTGATTTCAGCTT
GCATTTCCCTGATGACCAAGTGATGGAGACCACTTTTTGTGTGCATATTGGCTATCCATC
TGTCTTTGTGAAGTGTCTTTTCAAATCCTTTGCCTATTTTAAACACTGGATTGTTTTCAT
TATTGAGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved