Canis_familiaris Locus Mono:64:SNORA52
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:64:SNORA52
Canis_familiaris
Mono:64:SNORA52
25
SNORA52
1001..1135
2135
TTTTAATTGCAGGATACTATATCCAGATCTAAGAATGTGTGTCCTTGCCGGTGGGAGAA
TATACCCAGTGGATATTTATGCCCAGGGTCTGTCCAGTTCAGCCTCACTGTCAGTAGATC
CAGACAATTCCATTTGCATAATGAACTCTCTGAGCTGTCTTTAAAGCCTCTGCCAGCAAA
GATTAAGGATTAGCTGCCGAGGGATTATTGCTATATCCCCTTAGGTGAGCTCTCAGATGC
TGTCTACTCTGAGTTGAATTGCTGACCCCTAATTTGAGGGCTGAGTGTTAGTGGTTTGCG
AAGACTTCTTAAGTGCCTGAGTTTTGATTATCTCACTGACATCTAGAGAAAGGGTGGCAG
GACAACAAGCCAGGCTAAGCGACTGAAAAAGGAGTCTCACATTAACAGGCAAGAAATTGA
ATTGCAGTGTTTAAAAAGTATTCATTCAGCACCCAATATCAGAAAAATTTGGCCAAGTTG
TTTTGGAAAGTAAAAATTCCTATAGATTGACTAAAATTTCCCTTTTCATTGCAGTTAGAA
CTCCCTTCGCTGTGCAAACTGATGACCCCAAAGGTCATTTAGGTAGGGTAGATACTGAGA
CAAATTCAAAGGTAAACAAAACCATTGTTTAAGAAATATTTCAAATTATAATCAAAGTAA
TGTATATATAAACACAAACATAAAGCTACAAAGAAAAGCCACATTTTTTCTTCCTTAGAG
AAAACTTCTTGGACTATTTCTATTTTAGTAGTCTTAATTATAAACTCAATAACTCCAAGT
AATGTATTAATGCCATTAAGTCTCAATTTCTAATTCTTTAGCTATATTTATTATTTATTG
TGAAAAATAGTCATTCTATATCCTGCAGTCATCCCTCCTCCCAGTGTGTTTTTAAATACA
GTCTGTTGATTATTATCAATATATTCTTAAATAACTTGAATATTTATTGATTTATCCAAT
AACTTTAGGTATCTTAGTTTCTTCCTATATAAGAAGAAATATGATTTGGCCTAATCCCCA
CTGGTCAGCCTGTGGCCTTCTGAGTTTCACCTCAGGACCAGATCACTCTAGAAGCCTTAC
CCAGAGAAGTGAGCAGAGCTTCAGTAGGATTGTGCCAGAGGTGCTTCTAGATCTCGGTAG
GGTGGGCATAGTAGTGGGGAGAAAAAATGATATCTTTCTACCTCCATGTACCACATCTTT
CCTAATACACCATCATTCAACTTTTCTCAGCTATACTTCTACAATCTTGTATTCGAAATT
TATAACATTTATATAATTTTTTAAGCCTTAAACAGTACTTTTACAACCAGAAGCGTATTT
GCCACCTCCCTGTGAAGGAACATTTGGCAAAGAATGGAAACATTTGAGATCATCAGGACT
GGTGTCTCAAAGTCATCTACTGGGTAGAGGTTGGGGCTGCTGCTAAACATCCTACAGTGA
ACAGGATACTCTCCTACAGCAAAGAATTGTTTGGACCAAATGTCAGTAGCTCTAAGTTTG
AGAAAACCTGGACTCTCTCTGTTTATTCTGAAAAACATAAACCACAAAAGACAATTTTTA
AAATATTGTGTGATGGACCCTTTTGAAGAACCAGGTAATAGTTTCTATGCTATTCAAAGG
AGAACGTTGAAAGCACCAAGGTTGAATGACATCCATTTTCTTAAACTTCTTTATTCAGTA
GAAATCATGCCACATTGCTTCCTACCTGGATCATGATTTTTTTGTACATTTTTGTCATTC
CTGGAATTTCTAATTTTAATGCTTATTTTATTTGCTTATTTTAATCTCATTGAAAGAAGA
AATATATATATTTCTTTATTATACTACTAGGATTATGCAGCTCTTTGAGAAAATGTCAGT
TTTGTATAGACTGTTTTTCATGACTGCTGTGTGGCTGTCATACAGGAGTTTTTTTCTCCT
CTCTCTTTCATGCTCCTCCCCAATCATTTCAGATTTGGCATCTTCAGGTCTTAGATTCTT
TTTTTTCATTTTGCCAATATATATTCTCCTGTAATTATTTCAAGAATGCTATAGCACAGA
TGGAAAGGTTTGAATACCTTTATACTTAATGGTTTAGAAAGCTAGGGAATCCCAGTTTCA
AAACCATTTACCTCAAAACTTCGAGGATGTTATTTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved