Canis_familiaris Locus Poly:19:SNORA73
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:19:SNORA73
Canis_familiaris
Poly:19:SNORA73
2
SNORA73, SNORA73
1001..1205, 1931..2134
3134
CAGGGCGCTGCGCAGGCGCAATAGAGATACCTTGACTTCCGCCCGCTTCAGAAGGTATA
AATAAGGATGCCTTGGGGGTTGTACGGCCTTTTGGAGAAAGACTGCGGCGCCGTTTGGTC
TTTAGTAGGTAAGAGTTTTACCCTTTCGGTTGGTTACTTCTAGCTTTAGTACCCCGGGGC
CTGCCAGCAAGCTGTTCCTGTGGGCATCGTGCTCTCTGGAGCCCCTTCTGCGGCGTCCAT
GCTGACTACGCTTGCTCGCGCAGCGGGGCTGGGCAGGATGTGGGCCGCGGAGGCCTCGCG
AGCCGCGGGCCTTGCGCATAGTCCAGGCGCTCGCGCTGAGACCTACGGGGCTGCCGCTTC
ACGCACCAGGATGCCAGATGCTCGGCCCACCCCGCCCCTGTTGTTTGATCTGGTCTCCTA
GGAAGCGGTGGGATTGCATGCCGATCATTCTATTCCCGACGGCCCATCGGAGATTAAGAA
TCGATTTCGAAAGCGAGCGTTCTTAATTCTGCCGCTTGTTTTATGACGTAGGGTGATCTC
AGGGCGCACTCCTGATGGCCGAGTTGTAGATAGGACCCGTAATTGCTGTGTCAGCGCTCT
GGATGTGCCATTTCTTTTCTTTTTAAACATTTTATTCATGAAAGAGAGAGGCAGAGGGAG
AAACCGGCTCCATGCAGGGAGCCCGATGCGGGACTCGATCCCGGGTCTCCAGGATCACGC
CCTGGGCCGAAGGCGGCGCTGAGCCACCCAGGGACCCGCTGGATGTGCCATTTCTTAAAC
AGTAGTGCTAATCGCCTACTGGGATTTTTAGCTCTGTTTTGGGTACCTGGCTGAAAGTGC
ATTTAGACTACTGACCTGAGACTCCTGGTCGGTATTGAACTCGAACTTCGTTGACACTTG
GGAATTTAGTATCTACCCCAGAATGGATATCCTGGGGAAGTCACCCTCTACTGGTTGAAA
TTTATTTCTAGCTCTTTAGTTAGCAAATGAAATTACGGTGACCAACGTGGATACTCCCGG
GAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCGTGCGGGAGCTCAGGGCTCTGCCCGGT
GACGTACAGTCCCCTTCCACAACGTTGGAGATGAAGCCGGGCCTTGAGTCTGCGCCTGCA
TATTCCTACAGCTTCTCAGAGTCCTGTGGACCATGACTGAGGAGACAAACCATGCAGGAA
ACAGCTCTCTAGAGCACCCCCTATCTGGATATAGGTTGATTGGAAAGAAATCTGCTTTTA
TTACCTGCTGTACAACTGGATTAAGCTCTTACCTTACTTTGTTTTTGCAGCAATGGCTAA
GGATTCCAAATAATTTGATCTGAGGTAAGTAAATCCAAAAATTGGGGGTAAGAATTGGTT
TTGGCTTGTCGGTGTTTTCCTGTTGACATTTAATCATTCCAGCCCAGTTCTTTTCATGAA
TGTGCTCCTTGCATTTAATATATCCAGATTAAAACTTCACTGTATTCTTGTTGGCATATT
GACAGTTTTGTAGATGTATGCTCATGTCTGGGAAGATTGCTTTTTATTGAGTAAAGGTTA
ATATTTTCGCATCTTTGTCTGTCATGTGATACGGTAGAAATTTCTGCTAATTTTGGATGA
ATTAACCAAAACCAAGATTAGCAAAACTTCGTGTATACAAACCATATAAATAAAGCATGC
ATACTCCGTCAAAGTCTGTGCATGGGAGCCAAGGATTTAGTCTCCAGTACAAGCCCTGTT
AGATAACAGAAATGAAAGTGAGCATATGTACCCGCATATTCCTAGGACAGTAAGTACAGA
AACCATGAAACAGTCAGTAGTAATAACTGGGTTTTAAAGAAGCTTTCCTCAGATTCACTT
GGGCAGAATGGAATGCGGAAAATGAAATCTCTTGAAAATGTTTTGAGAGTGAGGCTGTTT
AATCAGGCATTCCAACGTGGATACTCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCAGGT
GGCGTATGGGAGCTCAGGGCTCTGCCCCGTGACGTACAGTCCCTTTCCACAACGTTGGAG
ATGAAGCCGGGCTTGAGTCTGCGCCTGCATATTCCTACAGCTTCTCAGAGTCCTGTGGAC
CATGACTGAGGAGACAAACCATGCAGGAAACATCTAATGAAAACTAAAATGAAATTTTTT
AGTGGTCGTTATTAGGAGTCTGATCCTCTTTTTTTTTTTTTTCCCCCCATTCAGGAAAGA
AGAGGAGCTTCACTTAACTGGCAGTTGATCTTTTGTGTTCTTTATTTGGCAGGGGAGGGT
TGGTAAAATGATAAATGCTGTTTATAAGATAAGCGTGGAGGTTTGGAAGCTTGGGCATAT
TTGACCCCCTTTTGAAACTTCCCTTTAAGTAAATCGGGGTGGTGGGGAGCAGGTTAGAAA
AGGAAGTTCTTAGGTATGGCTCTAGAACCATACTTTTTATAAAGATTTTATTTATTCATG
AGAGGCAGAGGGAGAAGCAGGCTCCACACAAGGAGCCCCATGTGGGAATCCATCCTGAGC
CAAATGCAGACAGGCACTCAACCACAGAGCCACAAACCATACTTTTAAGAATCGGGACTG
ATGCCTGCTAAAATTGAGGAATGTGAGCAGTACTGAGTATGGGCAAGTCTATTAAAACAG
TATGGTCCTTTCACCCACGAAACCAGAAGATTCCAGAATGCCTATGAGGAGAAAACTTCT
CTTTAAAAAAACTAAAATAACTGCCTTTTTCCGATATTCTCAAGTTAAGTGGGTTTTCTA
TTAAAGATCCAGGTCTGTTTATGATGTACTTATGAATTATAATAAAGATGACTGCATATT
TGTGTGGCTTTTTTTTTTATGTAAACGTTTGGTTGGTTCTGCATTGATTAAAGGCCTTAG
GCTTGTGTGTTTTTGGTCTCCTGATACTTGGTTACTCTTACACTGGAGAGAACATGTTGA
TTCTTACCAGTTACTAAGTGTGTATGTAAGAGCCTCCTGGTTGCATTCAAAGGGATGTAA
TGGTACAGAGCGAATTTAGAGGACCTCTTTTTTTTTTTTTTTTTTTTTTTTGGATTTTAT
TCATGAGGCGGGGGGTGGGGGCAGAGGGAGAAGCAGGCTCTGTGCAGGGAGCCCGGTTAA
AATCTACTGCCAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved