Canis_familiaris Locus Mono:167:SNORA12
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:167:SNORA12
Canis_familiaris
Mono:167:SNORA12
1
SNORA12
1001..1114
2114
TACCTTTCCATCCTCTTGATAATGGCCAGTGCTTACGTCCATTTTTGTAGTGACTAAGT
CATACTTTGGAGTTTGGCCTTGTGATCCATCTCCTGATAAAGATGAAAGGAGCCTTAATC
AGTAGCTCAGGCAAACTGCATTTCATTCCATGCCAAATGCCAGCCTCTGCCATCTGTTCC
GAGGCCCAAGAACAACAGGTATGTTTTGATGGACACTGAAAGCCCACAAGAAGGGGTGCC
TGCGTGGCTCAGTCAGTTAAGTGTCTGACTCTTGATCTCAGCTAATGAAAGCCCACAAGA
AAGTACATGTCCATGTGTGTGGCAACCCTCCTCTTTCCTTGCTTATGTCCTAGAGGCTAG
TAAGGACCTTTAAAAGGACCTGTACCTTTTAAGTCTATCTTGTCTGTGTTCTAGATATCA
GATAAAGTTGAGTAGAAAAAACAAAACAACAACAACAAAAAAAAACAAATGTTAAGATGA
GACAAAATCCAAAGCAGATCAGCTTTTCTTACCTCTTAAGATCTATATTAGTTTTTTTTT
TTCTAGTTGCATAAATAAATGACGGTGTTATTTATAGTAACCTACCACCTTTCCCAGTTC
TTGCAACCATGGTGCCCTGGCAAAGCTGCTTGGAGGGATCCTCGGCATGGCCTGGTTTAA
CCCACGGTTGGGGGCTGAGCTAGCAAAGGCCTTTCCGAGGTTCCAGCGGACTACTCTGCA
GTCTCCTCATAACCTCTCATAAGCCTGCTGAACTAACCTTCCATTCTAAATACATAAAAT
CAGAATTGTGATAAAATAATAACAGTGAGATGGAGCAGAGTTTGAATTTAATTATTAATG
AAACAAATGACCCAAGAGAGTAAGAACATAAAGTTATACATTTAATTTAATCCTTGTTTA
AATTCAGTGTTTGAGGCAAAATTTAACCATAACCTATTCTCACAATGACAAGGCTGTCTA
GCCACCAGAACATCCAAACTCCTTTTGAGAGAGTTTATTTTCATAGTGGGGGTTTGCTCT
CTGGCATACTTGTTAGGTTTTCAAGGGAGCCTGACTCTGCCACATATACTAGATAGAAGC
TGGCAAGACTTGATGGGAGATTGGCTCCCACATGTAGAAAGAATAAGGGGAAAAAATGTG
TATTTCCATCTCATTATAAAAGCATATTAACTATGCAAAAAGTTTTAATATGAAAAAGAG
AGAAAATAATCACTTGAATTCCCACCAATCAGCAATATTAACATCTTAATGTGTACATAT
CCAATATTCTTGCTGTTCACATAAGTCTTATATGGTTACATGGTTCATCACCATGCTCAT
TTCTGCTTTTACATTAGTATTTAATATTTAAAGGAACTTTATAGAGTTTATTATATTATG
AAACTGAGTCAAACTAAACAGTTCTTCCAGTTAAAGGAATCAGGGCTGAGTTCTACTTTG
CTTATTAAAAGTGAGTTTTAAGACTTGGCATTGACATCTCAGTGCAGAGGAAAGATGTCA
TATGTCTTGTTTCAAATCAAAGAAATAAGAAATTACAAAATAAAATTTAATTTTTCTTTT
GGTATTTTTCTATATCAAATTTAAAATATAATGTTCAATTAAAAGTAATAGTATAATGAC
CTAATATATAATATAGTAGCCCAAATTATCATAGGATTAATGATCCTTTTCACAATTGTT
GAGTTTTTAGTACTGCTACAAGTTTTTCACATTGGCAAATAACATGCTGTCAAAATATCT
GCACATATGACTTGTTTCCTTCTTCTGGAATTAAAGTTTTTCAGAAGTAGCACTTGCTTG
GTCATAGAATATAATCATATTTGTATGTATATACTTCAGAAATTAAATACTACACCAAAA
AAATTTGTTTCTCTGACATGAACTCTATACTATGAATGCAATAGGTTTATCATTGAGTTT
CAAGCCAAAGTCACCAAGTTTTCAGCTAGGCTTCCTTGGTTTAAGAAAAAAGAGCAAAAT
TACTCATACTCTTTCTAAATCGAGGATAATACTCCTTGTAGTAGTAGTAATTCTACAACA
ACCAGCCACCCTCTGTGATATTCTTCTAATTTGCAAACTGTTTCATTCCTTGAAGCCAAT
AAGTGTTATACCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved