Canis_familiaris Locus Mono:1:SNORD116
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:1:SNORD116
Canis_familiaris
Mono:1:SNORD116
Un
SNORD116
1001..1095
2095
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACC
TTCCTTTGTTTTCCTGGCGGTGTCGCGTATGGTGGCGGCCCCTGCGGAAGAAGAGCGGAC
CAGGCCTTATTAACTTGCGCACGGATCACCAGAGGTAAGCTTTTGTTGTCTCTAAGTGTA
CTGATGGCACTAGAAGGTCCTGAGATGGCCTGCGGACCTGCCAGCCGGCTTGTGCTCCTG
GCCATGGACGTTGGCTCTCCAAGAAGATTGCCTTTGCCTCTTGCTCAGGGGCATAGCTGT
GGATGGTGTCCAGGGTACTGGAGGGTGCTGAGGCCACGGGGAGACCCTATGAGCTGTTCA
GCCTGTGTAGTTCAATATACCAGGAGGCCGAGAAAGTGCTTGGATCGATGATGACTCCCT
CAATCTGCATTCCTTGGAAAAGCTGAACAAAATGAGTGAGAACTCCCTGCCGTCGTTCTC
ATCGCAACTGAGGTCCAGCACGTTGTCTCCCCCAGGGAAGGAAAGAGTGAGGGACACCTT
CGTCGTGCCACACGCTAGCAACCGCCACCACCACCACCACCACCACCACCACCACCAGCA
ACACCACCACCACCATCTCCACCCAAGGGCCCTGGGATCAGAGTGCCTGGCGGAGGGCTG
AGGGCCTAGAAACCGTGTGCTCTCCTTGGGTGGGAGTCCTCGACTTGGTGGTCCTCCATG
ACATGTCTGGGCTTTGGTGGCGTCTCAGACAGCCAGCAGCCAAGTGATAGGAGTTGCGTT
AGGCGGCTTTGGCAGGGTCTTGAGAGCATCTATGTCAGAGTACATCGGCCAGGCCAAAGA
TTGAGCCAGTTCTCCTGCTGGTGTGTGGTGCCCCCCTTTCAGGGCCAGGTGCCGCCGGTG
TACAGGTGGACTGCGGACCGGGCAAGGAGCAATCTCTGTCCCAGGCCTCTGTCCCACGTT
CTCAGCTGAGCGCTGAACAGGGTTGCGGGAGGACAGGAAAGACACCAGATGGGTTCGGTG
CATTTGATAGAGCCGTAATTCATCTGAGGCCAGACAAGGACAGAGACACACAACTCGTAC
GCGCACACAAATACACATACAAACATACAGAAGGACACACACAGTCACACACACGCTCAC
ACACTCATAGTCGCATGCACAGGCAACAAACACAAACACACACACACACANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved