Canis_familiaris Locus Poly:23:SNORD12
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:23:SNORD12
Canis_familiaris
Poly:23:SNORD12
24
SNORD12, SNORD12
1001..1091, 3234..3327
4327
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCGACATGGCGGCGAGGCCGACGAGCCCCGGGGGC
CCCGACGTACGGCGAAGGGGGCGGGGCTAGAGCGGCCTTGGCAACCATTAGATCGCCTCG
GGCTGGGCGGCTTGCAAACTACATTTCCCAGAGGGCCTCGCGTGCCGCGGGACGGAAGGG
GAAGCGCCTCGGGTGCAGTGCGCAGACGCGAGAGCTTCTTCTGGTTATATAAGAGCGGTC
TGGATCCCTTTTCGGTCTTTTCCGTCCTCGGCGCTTTCCTCTTGGTGTTCTGTGGCCTTC
TGCTGCGTTCGATGTTGTGCGGGCACGGGAGCCCGGGTTTGCTGCTCTGTGCGGTGAGTG
GAGATAACCGCTGTTTTCCCTTCGAGGTCTCTGTACCGTCTTTTCCTTCTTTGCCGTCAC
CCTTGGCCGTGGCTCCATTTACTCTAAAAGGCGCCTTAAGGCGTCGGGGAGGCCGGTTAA
AAGTGGAAAAACCCGTGCCTGTGTGTGGACCCGAGTCCTTGGCTGGTGTAAATGATGACT
GAGCTTTTTTCCCCATCAGATCGACAATGCTGAGGTCTTTGAACACTTGCCAGTTAGTTC
TGATGCACCGGCCTCAAGAGGCCCGGCCACGTTCTTCCGACCGTGGGAAGATGGGGACTG
ATGCCCTTTGCTCTGTTGGTTCGCAGGTCTGCGCGATCACGGGGTACGGAATGGATCTCG
GAGGAGGGCGTCGCTGCTGGGCCTTCAAGAGAGCCCGCGGTAGATCCCTAGAGCCATCGG
TCTCCTGATCCCCGGCGTAAGCATTTGTCACCTGGCCCATTGTAGGAACCGCGTGTTCCG
GGAGCCTCTTCGTTTGCTAGGCAAACCTGGAGGGGGAGGGGTGAAGGTGTAACTGTAGCT
AATTGTACTTAACAAGTAAAGTGCGGTGGATACTTCTTTTTATTTCTTTAATATTTTATT
TATTTATGAGGCAGAGACAGGCAGAGGGAGAAGCAGGCTCCATGCAGGGAGCCCTTTGCG
GGACTCGATCCCGGGTCCCCAGGATCACGCCCTGGGCTGAAGGCGGCGCTAAACCGCTGG
GCCACTGGGGCTGCCCTGGATACTTCTTATCGGTTATTTAAAAGTATCCGTTAGACATTA
GTGAAAAATTAGTTTAAGGAAAAAAATTCCCCGAAGTGGAAAAATCTCTTTAAAGCAAAC
AGATGTGAATTTTTTTTTTTGAAGATTTTATTCTTGAGAGAAGTAGAGACCCCCGCAGAG
GGAGAAGTGGGCTCCATGCAAGGAGCTTGAGGTGGGACTCGAACCCGGGAATCCAGGATC
ACGCACTGAGCCACCCAGGCATGCCTAGATGTTAGTTAGTTCTTAAATCACATTTTTGGA
TCCCATTTCCTGGTATGTGATGTATTTTTTGATAAACGATTCTTCAGAGCATTTTTTCAA
GTGGATGGGAGACTTGGTAGGGTAGAGGATGGCAGCGCAGGAGGGTAGGTGAAAGAATTC
ACTTGAGACGAGATGTTTGAATACACTGCAGAGGAGCTGCAGGTGGGAGAGACTGAGGAA
GCAGTGGTGGGGAGCTGTAGTTAAAGGGGAAGATCAGGACGTATGGAAATGTTTATATAG
TTCACTGGTGATCTATGGATTATGGAGATTTTAAGGTGGGTGGTCTAATGGGTTTGTTAG
CATTTAGCCCAGTGGTAGTTGTGGGCCCTTTTATGTTATTCAGGTTCCCATTGCTCAAGC
CTGTTGGCTAAAAGTGGCCTCTACAAGTGAGGACATTATATATTTTTAATCTCTATGCAC
AATGTGGGACTCAGACGCCGAACCTAGAGATCAAGAGTCACATGCTCTAGCAACCCAGCC
ATCCAGGCACCCCATCTGAGGATTTTTTTTTCCTAAAGGAAAGCTAAATTTGTATTTTAG
GTTGACTTGGGCACTCAGATTAATTTCCAACTGTGTGCACTTGAAATTCATTTCAGTCCA
GGGATGATGGCCCCTTGAGGGCAGGACTTACTGGGGAACAGATCTATCTGTGCCAGCGTG
TTCCTGTGAGTCAGGTTTTTGGTGATGGCATTTTGCATTAAAATATAAGGTCCAAAAAAA
ACCAGATGGTGACAGGTGGTCAAAATCCTGTGGACACTTGCCTCCATAAGCCAACCATTT
TCCCAGAACTCTTCCAGCCACATTGGCCCCAAATACAAGTTCAGAAGGCAAGAATTTATC
TTAACTGTTACTGCCAATAACAGGATGGGCTCAAGCATGGAGTTGGTGGGCATAGAAGCA
GACTAACCAAATCTCACTCGTTCAGCTCTAAGAATTAGCTTCCTACTGGCATATATGATG
ACTGAACTTTTTTCCCCGACAGATCGACCATGTTGATCCAACTTTTCTAAGCCAGTTTCT
GTCTGATATGCCAGCTTGTACAGCTCCTTTGTCCCTCTCTTGTGGGCATCTAGCTGTTCA
GAACTCATGTTTGTTTTTTTATCCCAGATTTAATGTTGGCAAGAGACTTGGAGTGGACCA
GGAGTGGAAAGGAGTTGGTAAGTGATGTCCACGTGGCTGAATAGACACAGGATCTGGAGA
ATGGATGAGATTGTAAATCCTTTTAAAAAAGTAATCCATATCCATCGTAGGGCTCGTATT
CATGTTCCCAAGATCAAGTCGTACTTTTCCAACTGAGCCAGCCATGTGCCCCTATTTTTT
AAATATGGGACTGACAGATTTAAACAGCTTGTGTTCTGCCGTAACTCAAATTTGGCCATT
GCAACTGATGACGTAACTTTTTTCCCCATCAGATCGACCCTGTTGATCTAAGTGAACCAT
TAGCCAGTGTTTTGTCTGATGCATTGGCCCCAGAGAACTTTTATCCCTGTCACTGTATTC
TGCTTACCACTAAGGCTACCTTCTATGTGGAATTTGGGCTTGGTTTGTGGGGACCCTCCC
CCAGGAATCAGGTCACTTATCTTGGTTTTTATCTGCTCACTTCCTACAGGCCTGGAGCCC
TGTGAAGCCACAGGGCAGTAAATAGATGGCAGCCTGATGTGCTTGGTTCAGTCTGTCCTG
TTACAGGTGAGGTTTTTGCAAGTGGCATTATCTTAAGTCAGCCCCTGTAGATGTAAGATG
ATTAAATCACCCTCCCCCCCCCCCCATAGAGTTGAGTTTACCTGTTCAGGAGTAACCTGG
GAAACCATTTCCCAAATAGGTATGTAAAACAGGAGAATGAACAGTAGGATTGTTGACCTA
TTGGTACTACTAGGTCTTGGAAGAAAGGTAAAAATGAACAGTTAATTCTGCCTTAGAAAT
AAGCTTCAGGTCACATTTTGGCTGGGATTCTTTTTGTGTTTTTTTGTTTTTTAAAAAGAT
TTTATTTGTTAATGAGAGAGAGGCAGAGACCCAGGCAGAGGGAGAAGCAGCAGGCTCCAC
ACAAGGATGTGGGATTCGGTCCGGGAACTGGGATCACGCCCCGAGCCTAAGACAGACATT
CAACCATTGAGCCCCCCGGGCTTTCCCCAGTGGGGATTTTTTTGGAAAGATTGAGTTCCT
CAAACTGTTAAAAGTCCCCCTTTTGGGCTCCAGGGGACTTTTTAAAAGGGCACCAGGCTT
GAAGAATTTCCCTGGCTTGGGAAGTGGAAAGTATTCCCCCCCCCCCCCCCCCCAGTTCCT
GAAGTCTTAATTAGTGGGAAATCTCCCACATCCCAAACAAGGAACTTTTTACATCAGAAT
TAAATACTGAATGTAATCTTTTTCAGGAGTTTCTCAACTTTGTGGAGTTTGGAATACAAG
GCTTCTTGGAAAAGATTGACTGTATGCTTACCTGAGAAAGGGTGATCTTGCTGAATCTGT
CTCCCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved