Canis_familiaris Locus Mono:96:SNORA51
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:96:SNORA51
Canis_familiaris
Mono:96:SNORA51
6
SNORA51
1001..1130
2130
GAAATGGTTTTTGAAAAGAAGTGTTGATTGAATCAGGATCTTAAGGATGAATAGGTAGT
CTTTTGGCATGGAATACATAAAAGGCAGTTCAAAGAACACTGAGCAAAGATAGAGTTCAT
TAGTTTTCTATTGCTGCTATAACAAATTGCCACAAACTTAGTGAATTTATTTATTTATTT
TCAGTTTTTTGTTTAAATTCTAGTTAGTTAACATACAGTGCAATAGTGGCTTCAGGAGTA
GAATTCAGTGATTCATCACTTACGTACAACACCCAATGCTCATCATAATACATGTCCTCC
TTCATATCCATCATCCATCTAGCCCATCCCCTACCCACCTCCCTCCAGCAACCCTCAGTT
TCTTCTCTATTGTTAAGAGTCTCTTGTGGTTCATTTCTCTCCCTTTTTTTTTTCCCCAAT
CCTATATGTTCATCTGTTTTGTTTCTTAAATTCCACATATGAGTGAAATCATATGGTATT
TGTCTTTCTCTGACTGACTTATTTTCCTTAGCATAATACCCTCTAGTTCCATTCATGTCA
TTCATTTCATATGGCAAGATTTCATTTTCTTGATTGTTGAGTAGTATTCCAGTGTGCATG
TGTGTGTGTGTGTGTGTGTGTGTGTGTCTGTGTGTTTGTACCATATCTTATTTATGGATT
TATTTTTTTAAGATTATTGTAAATTTTATTTTATTTATTTATGAGAGACACAGAGAAAGA
GACAGAGACAGGGGCAGAGGGAGAAGGAGCCTCCCTGGAGCCAAAGACAGATGCTCAACC
ACAGAACCACTCAGGAGCCCCTTAAGATTTTATTTTTAAGTAATTTCTATGCTCAACATG
GGGCTTGAATTTACAACCCCAAGATCAAGAGTCACATGCTAAACTAGCCAGGCACCCCAA
ACTTAGTATATTAAACAAAACAACACAATAAATAAGTATCTACCGATAATTACTTTGAAT
GTAAATGGACTTAAATGCTCCAATAGAAACATCTAAGTTTAAGCCTCCTGGTGCTTACCA
TATGCTGTGTTCTTACACTGTACAGAAAGGGAAGGCAGAGTAATTAAACCGACCCTTATT
CACCCCAACCTAGGCCCTTTGCCTGGTCTGTGTTATGAATCGGTGACCTGGAGGAAAAAA
AGACAGATGGATAAAGAAACAAGACCCCTCTCTATGCTACCTACAGGAGACTCATTTCAA
TCTAAGGAAATCTGCAGATTGAAAGTGAGAGGATGGAGAAATATCTATCATGCAAAAAGA
TACCTAAAGAAATCCAGAGTAGAGATGCTTATACCAAACAAAATAAACCTTAAACCAAAT
ATCATAACAAGAGACAAAGAAAGACACTATGTAATAAGAAAGGGGTAATCCAACAAGAAG
ATATAACAATTGTAAATATTTATGCACCCAACATAGGGTCACCAAAATATATTAAGTAGT
ATATTAATAAAAAACATAGTGGAACTAATCAATAATAATACAGTAATAGGAGGGGACTTT
AATGCCCTACTTACAGCAATGGACAGATAATCTAAGCAGAACATCAACAAGGAAACAGTG
GCTTTCAAACTGTGGGCCCATTTCGGTAAAGGGCTAGAGTGCGGATCCAGTGGGGCATGG
GGGGAAGCGGGTCGGTCAGGCGGGGGCTCCAGGCGGAGGGGGCTGCACCCTGCTGCTTTC
GGGAGCTGCGGCTCCGGGAGTGCGATTCCAGCACCACAGGGCCCGGATCCCAGGGCGCTG
AGCGGACACAGCTCACGATCCTGCGCTCCACGCCCGCCACCCTGGAGTGGTGGAGGCGGG
GAGGGCACAGAACAGTGAGGACTCTCCTGCTGCTAGGTTCCCCCAAGATGTGCAGATCAG
TGCACCCGCGCCAGCCTGGGAGCATCTAGGCCAGTGCAGACTAGAAGCTGCGGTAGTCAC
TGTGGCGAGCTGACTCCAGGGCTGGAAACCTGGCCGCCACCATTGTTCTTGTTCCTCCTG
ATGTCACCCTGTGCCTGGGACAGAGCTGGGCCACCAGAAACAGAAGCCTCATGGGGCCAA
CAGCTACCACTGAACCCGGCATCTGGCGGGGGGTGGGGCAGCACCCCCAGGTACACGCAC
ATGAGAGTCAGCACAGCAGGCCCCTCCCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved