Canis_familiaris Locus Mono:27:SNORD47
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:27:SNORD47
Canis_familiaris
Mono:27:SNORD47
5
SNORD47
1001..1071
2071
CATTCCACCTGCAAGGTCTTTTGACTCTCACTTTGATAAATTTGGTTTAAGCTTTATTG
GGCACCCACTGTGTGTCTGCCCTGGGATAGGTGCTGGGGATGAATTAGACATGATCCCAG
CCTTCAAGGGGCTCACAGCAGAGTAGGGAAGGCAGCTTGTGTGGTTCTAGTACCTGCTGA
CTCTTGTTGGCCCTGGAGGGCTCAGGGTCCTGGGAGCATTGCACAAGGGAAAGGAACTGG
CCCCTGAGTGAGGGGAATGGGTGTGATGAATTCAGGCTGACGGGACCCCAGTGTGTGATG
TCTGAGTCAGCCATCCCTTCCTCAAAGGACTGCTCCCTGTGGAATAGAAGACCTTCCTCA
GAGAGGCCTCTATGGGTCCTTGTGGCCGGTCCTCAGACAAAGGGCACAGGCCTGCCCTTC
TCCCCTCTGCCTCTCTCAGAGAGTCCCATTTATCTAAGAGGACTGTTAGTGGCCTTCACT
AAAAAAAAAAAAAAAAAAAAAAAGCACATCTACTTCTTCCAAGGTGGTAATACAATGGAG
CAAGACTTTCCACTGGAGGAGGGCCTGTTGGACCTCTGGCCTGGGCTTTTTTTTTTTTTT
TTTTTCAGATTTTATTTATTTATTCATGAGAGACACACAGAGAGAGGCAGAGACACAGGC
AGAGGGAGAAGCAGGCTCCCTGCAGGGAGCCCGATACGGGACTTGATCCCAGGACCTGAT
CACGACCTGAGCAGACGCTCAACCACTGAACCACCCAGGCATCCCTGGCCTGGGCTTTTA
ACTCAGAATCCCGCTTTGCCTTCTGGCATGTACCTGGAGACCAGGTGCCCAGGAATGGCC
TCAAGCCAGAAAGCCTGCCTCGTGAGGGCTACAGGTATTGCTCCATCCTGGCTCCTCCCT
GGCCTCCACCGCCACCACCAGCAGCCAGGGTCCCAGGTGTCTGAGGTGATGGTGGCGGCG
ATGGCAGAGGTGATGGATGGGGAGCACAATAAACAGCACGTAACCAGTGATGTATGATTT
TGCCAGATGACATAGAATGCTATCACTCATAAAACCATTCCATTTTGTGGTTAAAGGAGA
TGTGGCCTATGTATACAATGGAATATTACTCAGCCCTCAGAAAGGATGAATGCCCACCAT
TTACATCGACGTGGATGGAACTGGAGGGTATGATGCTGAGTGAAATAAGTCAGAGAAAGA
TGATTATCACGTGGCTTCACTCATATGTGGAATATAAGAAATAGTGAAAGGGGCCATAAG
GGAAGGAAGGGAAACTGAGTGGGGAAAAATTAGAGAGGAAGACAAACCATGAGAGACTCC
TGACTCTGGGGAACAAAGGGTTGCAGAAGGGGAGGGGGTGGGAGGATGGGGTAACTGGGT
GATGGGCATTAAGGAGGGCACACGATGGGATGAATGAATACTGGGTGTTATACTGTACGT
TGGAAAATGGAATTTAAATAAAATTAAGAAAACAACGACAATAAACAGCATGTTTGGCAC
CCCAGCTCTTACTTGCTTAAGCTGCCAAGTCACCCACCTAGCCACCCCTCATTCTAGTTT
CCTATCTCAGGGCCTGCTTCTTCCTCCTGCTAGGCACCTGGCATGACCTCTGCTCCACAC
CACTAGAATCTCCAGGGTAGCTTGTTGTGCATGCATCTGTCCCCTGTCTGGGTCAGCACC
CCAGAGGCTCTGATTCTATTAATCCAGGGTGGGGCCTGGGTATTTGATTTTTTAAAGTCC
TAATCGATTCAGCCGTGTGTGTGTCCCGGGTTCAGTTCTCTGACTCAATGGAGCCTGTGA
TGTGTGTGGATGATGCCCTGGAACTGGTTCTCCAGCCAAGCCAGGCTGTTCTGTGCCCTT
CCTGGAGGAGCTCAAGATGAGCTTAGATGCACCGGCCGGCCTGGAGGGGCCGGCTCAGAT
GAGGCCCCAGGCAGTGGAGTGTGTGTGCCAGGGGGTGTGTGGTTGGCAGAGGGAAGGGAG
AGGAGGGGGCAGTGCCTCAGCCACCCATCCAGTTGTTGGTGGCATGGAGGCAGAGTGGGG
AATGGCCTGGCTCTGCCATCAAGGCTGTAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved