Canis_familiaris Locus Mono:75:SNORD115
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:75:SNORD115
Canis_familiaris
Mono:75:SNORD115
3
SNORD115
1001..1080
2080
ATGTGGGACTTGATCCCATGACCCCAGGATCATGCCCTGAGCTGAAGGCAGATGCTCCA
CCACTGAGCCACGCAGGCATCCCAAGAGGGTACCTCTTTCTCTGCATCCTTGTAAATGTT
AGTTGTTTCCTGTATTGTTAATTTTAGCCATTATGATAGGTGTGGGTGGTATCTTATTTG
TATTTTCCTGATGATAAGTCAGAAAACATTACTGTTTTCCTGAAAGTTTATTGAAAGTAT
AGAATTTTTCTGAGTATGGTTCCTACTCCATTTTGTTAGTTTCTTTGGTCTAAGTATACA
AGTATACATATTTACATTAATTATTGTATTTTTCTTTGTTCTGCTCTTGTCAAGATTGTA
AGATATTGAAGAGGACTTACAATATAACACAATGGCTTATTGGCCATCATGTAAAAGTTT
CATATATGGTTCCAAAGGATTCATAAAGTGATCACAATTTCAAGTGTCCTGACATCTGAT
TTCTAGATCCAGAGTTTGATGTGGCTGAAAGAGTATGATTTAATTTGAGTTTATATGCAA
TGAACCATGGCAAATATCCTGATGACCTCTTGACTAGATAGAATAAGATTGACAATGAAT
GTCTCCCATGTCTACAAACATCACCTGCATGTTTATACAAAGTTAAGAAGCCTGTATATA
TTGTCCTTTTTCTGCTGAGTGAATGAAAGCTGCACCAACTCTGTAATAAGTCATTTTTGC
AGAAATGATCATAGTAATTGCTTAACATAGAGTATGGATAAATCATGAGACCATGAAATA
TGCAGTAAAATATTTTATCTGTCTTACAACTGTCCACACAGAAAATGACTCTTTAAAAAA
GGATAGTTTGACTGTTGCCACAGAATGAGCCTATGTCGGCCAGGTGTTCATGATAGTAAA
TGACAAAAGTCATGTCTATTTTGACATCGCAAATTCTAAAATCTATCTCTGATGAGCATA
TACATGTCAAAGTGTATAAATTGTCAGGTAATGCTGTGGTTTAATCAAAGATGAGAACTC
ATATTATCTTGTAGAGAAATGATGGCCTAAAAATCATGTTTAATAACTTTACACTGAAGT
ACAATGTAGTCAGTAATGCCAAAGCAAAATGTTGACGTTCCATGTTTCCCTTATAGAGTA
ATAGGATTTGAGTCTTCAGGCAACAAGTCCCTTCAGGGAATCTTCTCTATAGTTTTCAAG
ATAACAACACATCCTCAAGTTTAGGCTATCTTTGGTGAGCCATATTTAGTCACAGAGGGC
CATCCTCAACACTAATCCTTACCTATATTTTTCTCATCAGTTTATTCAGTTAGAAGTTCT
GGAAAGAATTTCACTGTTGCATTAAAATCAAGGTGAATGGACATGTTTGATCATAGATAT
AGGTGACATAGAAAATTACACTATATAAGAGGCCTGACTTAAGAAGATAAATAAGTGGAT
CCTTTCAGAAAGCTAAGTATTGTAGATGTTTAATTTCTGTTTGGGAGGTAGGCCATTGGA
GTAGCATAATTAGAAACATTTTAAGTTATACCTGAAATGGCTCACACTCCAAATGAAGGA
AATATTTCCTTCATTACTCCTGGAAACATTACCAGGAAACATTACCATCTGTGTGTGCAC
AGGTTAGAAACTATCTAATATACATAAGAGACAATAACTGCTGGGCTCTTTACTGGATAC
TCGAAACAAATTCCTCTAAGGAAGAATCATGCCCATGGCATCCAGAGAATGAAATGCAAG
AATTAATCTGCCATTGGGTCTTGGCTCAAAGGGACTGTGGCCTTGGAGGATTATTAGGGT
TTTAAAATGTCAATTTAAGGAATTACGGGTTTATTGGTGATGCCAGTTTTTCTAATTGGC
TCCTTAATCTATTTAGCTTTGCCAAATGGAACACTAGCTTCACATTTGAAGTTCAAGACA
CAAGTCCTTTAGAAGATGGCACCATAAGGGAAAACAAAAACAAAAACAATTTTGGAAGTG
CTTATATAAATATAATGTTGAGATTGTTGGAGCCATGGTATCATCTCCATCATGAGGTTT
TGTCTGCCCAAAGTACAGAAATAAAGATATATATTACAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved