Canis_familiaris Locus Mono:115:SNORA67
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:115:SNORA67
Canis_familiaris
Mono:115:SNORA67
20
SNORA67
1001..1130
2130
GCATATACTTGTATATTTTTATATGTATGTGTATGTATGGGTATGTGTATAATACACAC
AGATACATGCATTAAAGAGGAGAAAAAGATAGGGAGAAAACATTGAAAAACTGCTTGGTC
TCCCTTACCTCCTCACTGGAAACTGAGGCATCCAATTTATATGCATAGAAAGTAGAAGTA
CAAACATGTTGGTCAGATGAATGATTAATTATACAAGGGTAAAATAGGAAACAACCAAAA
TACTCAGTAATAGAGGCTTGTTAAATCAACAATAATGCACCAGTATGAGTGAAAACTGTC
CAACCACTAAAATCAGGCTTTGGAGGAATATTTAATTACCCCAAAAATCTTTATATAGCA
GGTTTTTAAGTGAAGAAATCAGGCACCAGGGCAGACTGTGTATCAAAATCCTAAGATGAA
GATGATATGAAAAAAATCCCAAGGTAGTATAAAAAAAGTCCCAAGATAGTATACACGTGT
AAAAATAGGTATGAATAAATGCATACAATAGGGAGGACTCAGAATTAACAGTGGTTATTT
CTGCAAGGTCATTACTAGCAATCTTTATTCTCTATGTGTCCACTTGTGTGTTTGTGTGAT
TTATATCATATTTTACATCAACATGGATTATGTTTTAAATAATAATACTAAAAATGATAC
TTTCATCAACGATATTCAATAAAGTAAAAAAAAAAAACAAAAAATGACTCAGTGTTTTGG
AGAAAATCTCCTATTTACCTTCCTCTCCTATCCAGTTTGTTCTACCCAGAAAATCCCCAG
ATACATGTGCAGCTTTGTCATTGCTGCCACTTGCTTGTCCTTTTCTGTCTGTCCAACCAC
ATATTTCTACTGAAGGTTCTGTCTATGCTGGCTTTCCAAAGTAGCTTCTCCCATCTCAGG
TCATTCTTGATATTTGTCCTTCTACTTGCTGATATGTCCTTTCCAAAACCAGTGTTTAAT
TTTTCTATCAATCCAAGGTGATGCCCGTTCCGAGAGGCCTGCTCATGCCCCTCTTCATGT
TACTTTTCCTCTTCAGGAAAGTAACAACTTAGAATAAAATCTGGCATGCCTTCAGTTGCT
GGCGGGGAGGAGATTTCTGTTTCCTTGGCCTCCCTTTGGCTGCCGAAACGCATTTTGGTC
CCTTCTGGATTGATTGTGGCCTCTTCTCATTCACATGCTGACATGTCCTCTCTCCTGATC
TAGGCCAGAGGCGTAGATTTCTTTAGTCATCAACTATGATCTTCCTACCAACAGGGAAAA
CTCTATCCACAGAATAGGTTGTGGTGGATGGTTTGGCCCTACAGGCGTGGCTATTAACTT
GGAGACATTGAGTCCTCCTACAACAGCTCCACTGAGGAGACACCCCTTCAGTGTTGCTGA
CCTGCTACCTAGCCCTATTCAGGATTCAGTCTGGGGGGGTTGAAGAGGAGCAGGACAGAG
GAGGGAAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTCTTTGAATAAATGCCAGTT
TGATGCAAAGTAATAATACTTTTTCTGTAACATGTGTTTAAATGTACATAAGCTTCAAAG
ATATTATTTTAGGAGATGACTACATCTCCTTTCCATTGTTTCTCTTGTTGGTACTTCATA
GAGTGCTTGAGACCAAGATGTTGTTCAGCGGACTAATGACTGGCCAGCCTGGTTTTCTTA
ATCTATCTAGACTCCTAGATCTAAATCTTTCACAGTATTGGAAATGTGTAACAAAGCAGT
CATCCCTTCTCCCTACCACCCCCGCCCTTACTGCTTGAATTTAATGCTGCTATCAGGCAA
CAATGAATCTTTCACCTGGGGCAGAGAATGAGGATTCATGGACATTTGTAATCCAAAAAT
CAATGCTACCTTACAATATATCTACTTGTGATTGAGTCATTTTCTTTACTGGTTATTCTT
AAAGTGTATTGGATGCCCATAAAGGAGAACAGGAATGTATTATGATGGAATCTGTAACCA
TTTTTATGTATATGTATCTTTTTCTTTTTTTAGCAATCATGTCAACTCCTGAAGTACAAT
AGCCACATTGAGGTGGTATAGAATATTTATAAGGTTTCTGCACCTAGAGACAAGAAACTT
GCTATAAGACTTTGAGGGTGTTACACCATCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved