Canis_familiaris Locus Mono:86:SNORA51
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:86:SNORA51
Canis_familiaris
Mono:86:SNORA51
12
SNORA51
1001..1125
2125
AAGAGCATGTGTGGCTCCTGATACTTAGGCGGGTTCGCTTTCCATTATTTTAAATAATT
GTTAAGTCTCATCTAAATTATGTTTTAAATCTTGTTCCAGTGGTAAAAATAAAAAAGCAC
TTTTATCATCATCTTTTAAAAAACGACTGTACTTAAGACATAGTTGTCACCCTTGCTTTA
TCTTCCCTGGCTATAATCCAGATTCCATTAAAATCCTCGATGAAATTTGTCAAATAAAGC
TTACCAGCTTATAAATACAAATGTTCACAAGTTTTTCTTTTGGTGTGAATCTAGCTCTCT
CTTTGACTTTATAGGCTTCAGGCAGTCAGGAGGATGGTTTTTTATACATCACAGCTTATA
ACATGGCTGAATAAAGAGCATTTACTGGCCGATGGGCTCCAGTGTGGACTCACATGGAGG
AACCAATCAGGTGCTAAATGACCATAACTGGGCAAGTTGTCACAGCTGGATCACAAGGGG
CCAGATTAGGATAATGATAGCATAACCAAGACTCAAGACTTTACATTAGGACTCCTTATG
TTCCCATTGCTTAGTATTCGTATTGACTCTTGAACTTCAGAACATACTGAGCCTGTAAGC
AAGGGAAGAAGAGTTTGAACTTTGGGTAGAAAAATGTGGGACAGAAGAGAGGCAGGTTTC
GGCACCATCTGGATCTTTCAGTCCATCTTACATGATTTTTTATAAGATTTTATTTATTTA
TTAATGAGAGACACAGAGAAAGAGTCAGAGACATAGGCAGAAGGAGAAGCAGGCTCCCTA
GAGAGACCCTGATGTGGGACTCTATCCTAGGACCCTGGGATCATGACCTGAGCTAAAGGC
AGACGCTCAACCCCTGAACCACCCAGGTGCCCCCTTAGGTGCCCCTCCATCTTACACGAT
TGACATACTTTCCCCTTTTTGTCAGGAAGTGCTTCTGTATTTAGACAGAACCTCAGTGTC
TTTTGTCTTAAAATGACTCAGACAGTCACCTGGTACTCACCACTGGTGCTCACCACTGGC
TGTATTCTTATACTGACTGTACTGAAAGAGGAAGCAGAGTAAACCTACCTGTATACACAG
CCGCCCAGGGCCTTCACTTGTCTGTATTGTGAATGAAGGAAAATGGAGAAAATATACAAA
CAAATAAATAAATAAAATGACTGGGGCAGCGATGCTCTAAAAACCAACACCTTTCTCCCA
GATATGAACAAAGGAGAGACTCTAAGATCTCTTGAGTCCTTGTCAATATCCTTGGAAACA
GTTGAGAAGTCTCTCTAATGACAAAAGAAACTATGACAGAAATTTAAGGGATTATTGGCA
AGCACAGATCCTAACTGAGAAGGTTTAATCTTAAGAAGTTCTGCTAGGAACACTGTGGAA
AGTAGTATGACTTTAGGCTATGGAGGCACTTGTGTTTTTGGATGTCAGATGGGTGCCTAA
GACAGAGATCCAGGTCTTGTTGACTTCCAGTGTGTCACCCAGAGAGTTGATGGACAGACA
GATGCCCCATGTTTTTGTTCCGAGAAAGAGTCCTGCCAAAACCACATCCTGTTACAGTGC
TGCATCTAAGAGGATGTGTGTACTGCAGCATTAATTAGGAAATGCTCTTTCCAGTGGCCA
GACCCCTACTCGCTATGATCATGCTGTCACATCCAGCCAACGATCTAGCTCTGCCAAGTG
GACCACAAAAGGAGGGAGGCTCTTTTTTTTCACCCAAGTGTAAAAGACGCCTGTGGTAAG
CTCTTCCACGTTAGAAATTCACTCTTGCATGTCTTATGTCTCTCAATGATACCTCCAAGG
ATTTCATTTCTTAGACCTTAAGAGATCTTTGAGGAGATAAAGAGTGAGGATTATCAGGCA
GTCACTTGAAGAACAATAGACAAAGGCAGAGGCATCAGAATACACACCAGTGCCTGCACA
CATCAATGCCTTTGTTATGATATCAGATCAGGGTAATTTTCAAATGTCGTAATTTGGCAA
ATTGGATCCTCAAATAGGTGAATACGTTCACTTTAAAAAAATAGTACATTCACACAGAGA
CTGATTGCTCTTTTTTTTTTTTTTTTTGTAGTTTCTCTTCTCTGAGTGTTTGTTGTGTGT
GTTTAATGCTCTACCCTTTGTTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved