Canis_familiaris Locus Mono:125:SNORA67
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:125:SNORA67
Canis_familiaris
Mono:125:SNORA67
34
SNORA67
1001..1144
2144
TTCAGAAGGTAATACATGTATAAGATATATTTAATTTGTTATAGGCTTCGTATTTGTGG
AAATTTTATACACGTTGACCTTGGAAAGAAGAATTCCAAGACTAGATAATCTACTTTCTT
TATGGTTTTCCAGAGCAAAATTTCTCAATTGTGGTTTTTTTTAAGAGAACTTCCAAGAAC
AGGGAGAAAAGAGCTATAAATACCTCAATACTTGCTAGATGTTATACTTCTGAGAGTTAT
AACAAAAAGACAGAGCAAATCACTTTCACGCTTTAGTATTCCCATAACAACCTTTCTCAT
CCTTAATAATTCAGATGCTGATCCTCAAAACAGATTTGGGTTTGGCAGTATCTACTCATC
AAAAAGTGAACTTTGATACTTTCTTTGGTAATGGGTCTCTAAGAGTATCACGGGAAAACT
GTCTTATAGAGACCATTCTAAATTTCAGCAGCATTTAAAAACTACATTTCATAGTTGGCA
TTTTTTGCTAACTAGTTTAGGCCAAAGTTTTTATAAAGAGCAATTTCCCCATAGGTCTTT
ACCTGTACATCTTCACCTGCATTGTATTTTCCTTCTATTTCTTTACCTAGTTCACCTTCT
GGCAGCTTAAGATCCTCACGAACTTCACCAGTTTCTGTCAGCAGGGAAAGGTAACCATCT
TGAATGCATATGAGCTATTAAAAGAAATTGTATCATTTGCACTGATTAGATTATATTGGC
TATTTGTAATATTTATATAGTTAGGTTGCAATCCACAATAATTGTAGAGGTACAGTAATA
CACTAATATATTCTAGTGCTTAAAAATGCTAAACATATAAAAGCATAAAAGATGTACAGA
CTAAAAGTGTAAGTTCACTCTTTCCTGCACACCACCTTCCCCCAAATATATATATAATCA
TATATATATAACCATATATATACATATAAATATAGTATGTCCCAAAGAATTTATATTTAT
GTAAACAATACAAATAGTTGCTTTCGAAAAAATAAATGGGAATCCAAAACGATTCCCTTT
TCAAGGAGCCTGCTTGTGCCCATCTTCAGAAAAGTAGCAACTTGGAATAAAATCTGGAAT
GCTTTAGGTTGTTGGAGGAGAGGAGAGTGTTTGTTTCCTTTGCCTTCCTTTGGCTACCTA
CACATATAGCTATCAATCCCTTCTGGACTGTGCTCCCTTCTCCGGCACATGCCGAAGTTG
TCCTCTCCTTTGATCTAGGCCAGAACCATGGATGGACAGCAGGTTTCTTTAGACACCAGC
TATGACCTTCCCACCAACAGGGAAAACTGTATCCTTAGAAATCGGTAGTGATGGATGATC
TAGCTGTAAGAGTGTGGCCATTAACATGGTGACAGAAGACAGGAGGGCTCTTCAAGACAT
TGACACCTTCAACACCTCCATTGAGGAGATAGATACTCCTCAATGTTGCTGACTTCATCT
GAGGGGCTGCCGTGCTCTCTAACCCTACCTAGGATTCAGTCCATAGGGGGCTAAAGAGGA
GCAGGAGTGGGGAAGGAAGAGAGTCATGGGATGGACATCTTGTCATTTTTTTTCTTTGAA
TAAATGTCACTTTTTGAGGCAAGAAAAAAAAAAGGGATATTACAGGTATTTTTCAACAAA
TTGTTTTCACTTAACAATATGTCTCAGAAATCTTTCCAAATTGGAAACTATGGACCTACC
TTAGTCTCTTTAACCACTTCACAACTGCATAGGTAGATTGTAACTTATTTAAACTCTTTT
CCCATGGGCATAAAGTTAATTTTAGTTTTCCATGATTACAACGTGTTCTTTAATTGTAAA
CTTATAATTTACAATGTGATTATGAACAAACATCAATGGAAAATTTTGGGTCTTCAGTTT
GCTACCAACAACATTAGAAGCTAGAAACACTAGCTTGTTGATGATATTAATGAGACAAAC
TCAGTCTAACCTTCAAAAAGGCAGTTTTGACATCACTAAATTTTTTTATTATAGGAATGA
GGAAACAGGCTGTACTCTTATTCTAAAAGCATGTACGTTATCAGTATGCTCATACTTCTA
ACAGATTTTATAAAAGGCAGTTATTCAGAATACAAGATGCTAACATTGACAAACACAAAA
GGGGCCAAAGATACGATCCTTACCTCCCTTTAGTTACCATGATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved