Canis_familiaris Locus Mono:32:SNORA15
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:32:SNORA15
Canis_familiaris
Mono:32:SNORA15
5
SNORA15
1001..1149
2149
GCTCACACAGGAATGCCACTGTTAACTGGATATCAGTCCACTTTCACCCTTATGATTTT
GAGGAAAAGGACGCACAACCAACCAACTTACCACGCCGCCACCAGCTGAGTGCACGAGCA
CAGACATCCCTTCTCGGAGATTGGCAACTTCAAAGAGCATCATATAGGCTGTGACGAAGT
TCATGGGGAATGCAGCGGCCTCCGAGAAGCTCATGTCATCTGGGATCTTGTAGACAAACT
CCACTGGCGTGCAGACCACCTCTGCCCAGGCATTGTAATTGACAAATGCCATGACACGGT
CCCCGATCTGGAAACGGGGAGGCACAGGGTTAATGGAAACTTATTACTCTTTTCTTAAAG
ATTTCTCAAATCCTCTTAGGAACCTAAATGGAAACTATAGATTCCTTTCCTGAAAACACA
ACAAAACAACCAAACCCTCAAATATGCACCCCCTCACCTGCCTCCCAATTCCAAGGCATT
TGTGGATGCTCTGAAGCCCATCTATGAAAACTTGCCAGGGACTACGGAAGCCAGGTTCTC
TACCCTTCTTCTCAAGCATAACTATACAACGCCGTCACATCACACACCAGGCCATGTTCG
TGTCAGAAGCTCATTTTACCCACTCAACCTCTCATCCCATCTCTGTTTGGGAGTTGAGGA
AAATTAAGCCATAAGGAAGTTTAAATGGGCAGAGCTGGGAATAAAAATCACTCTCATTCG
TTTTATGCTGCTCCTTAGGGATTCCCTGCCAGGCTAGTTTATTGGGGTATTTGCATCACA
GGTTAGCTCTGAATTACGGATCACAGTAGATGTGATCAGAAGAGCCATGTAAATCTAAGT
GCAGAAGACTGAACAAGAACAACTAGACTTAGAGCAAAATAGGATACCGTGAGGTGTGAA
TAACAACTAACCCTTTTTTGGAACACATACCATATAATAGGCATTGTCCTAAGGGCATCA
CATGCTTTAACTCATCTGATCTTTACAAAACCCCTAGGAAGGCATGGCCAAATACTGTGT
TCTTTTTTATCAGTTGTTTACATAGCCAGACATCATGCAAAAAAAATAAGAAATAAAGCA
TTCTTCCCTATAGAGTGGTTACCATGGCATGCTAAGCTTTTCCATATCATTATTAAAGGG
AAATACAAATGAGTGAACTGATCCTAGGAGCTTGTGTGAACTGCCAAGCGCTGGTGAAGT
CAAACCACTCTGCTCTTTGACATTAGTTGCTTGGACTGCAACTTTCAAACATAATCTTCA
AACTGCTGTGCTCAGAGTGAATTTTCAATAAATGAATGGCTTTCATACTCGTGTGCTTTA
GTTTTTATATATTTATAACTGAGTCTCCTGTTTTATTTTCTCTGAAGCTTAGCACTTCTC
TTCTTCCCTACTCAACAAACAACAACAAAAGCCTCCTATGAGATGGGTCTATAAGAGCTC
ACATTACAGATGAATGATTATAGATTTTCCAGACATTGAAATTGAGGCTGAGAGAGATGA
AAGCACATGCCCAAGGTCATGCAGCTAGGGAGTAGCTGAGCAAGGATTTAAGTCTGGCAA
GGCTGATTCCAAATACAAGTGATTAATTCATCACACCTGAGGTAGGCGCTACAAAGAAGA
CATGGTTCTCTAAGGGTGTACACCAGGGGGACCTACCACCTCTGAGAATATTAGTGTAAC
TCTTTATGTTTCCTCAACTGTAAAATAAGTATATTAGGAAAGGGTCCTTATGGGGAGATT
AATATAATATGCATGCAGTGTATTTGTCATGGTGCATAGAAAGTGAGGAAAGAACACTCA
GTGTTAACTCTTAAAAAGAACAGACTGGTTTCTCATCCCATAGAACTGATGGAAAGGAGA
GGCTGCCCCACTGGCAGGGAGTCTCTCAATCCCTGGAAGGGTTGAAGACCAAATGATGAA
TGTTGGGATTTACCATTTTAAATGCAACCACTTAGACCAGAGGATAATCAAGGCAACACT
GGCATCCTTTTTTTTTTTTGCATAGAATCATGCATCCAAAGGTACATAACATCATGGAGT
ATGATGGCCCTGTGCCAACACAGAGGGCAGTGAAAAGTAGCTCAACCACCTTGGCAATGA
TGGTCACAGCCAGCACACCAGGGTTGACCACTCCAGGTCTCTCATTCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved