Canis_familiaris Locus Mono:145:SNORA73
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:145:SNORA73
Canis_familiaris
Mono:145:SNORA73
13
SNORA73
1001..1200
2200
AGAAAGAATCTCAAGCAGACTCCCCAGTGGCTTGAGATTCCCCCTCCTCCAACACACAG
GCGTTTGCTGTCTCTCTCATATAAATAAATATTAAAAAAAAATAAAAACTTGTTTTTGAT
AATGTATTTTTTGACAGCTAGCATAATTCTTGTTATGTGGTTGTTATTGATCCCCCAAGT
AGTTAGTGAGCACGTGAGCAGGCTTATAATAGTGAATAAAATATTAGTGGGCCCTCCTTA
GAGTAGAAGATAGAGAAAGATAGACAATGTGAGTTCAGGGCTATGTGTTCCATAGGTACC
CTTATGAGTCAGGGTAAAAGCCCATGTCATAATGCCATTTTAAACTAACCTGAGGAGTGG
GCCAGTAGTCAGGCAAAAAGGGAGAAATGCCTGGGCATAAGATGAGGGAGATGCAAAAGC
TTTGAGATAAGAGAGATCAGGTACATTTTAGAAATGGATACCGAATCTGTATGACTAATA
TAGGATGTAAAGGAGGGGTGGGAAAGAGGTACACAATAAATAAGGTGTAAGCCTGACTGC
CTGAGTTGTGTTAACAAGTTTAGGTTGGTTTGCACTGAAGGCTATGGAGAAACTTACAGG
ATTTTAAGGGAGAAGAGAGTGAAATACTCAGCTTTGTTCTGCAGCTTTTAGAGAATGGAT
TGAAAGTGAAGTAAGGTTGAATACAAGTAGGCAATTTAAAAGACTGTTGTTGCTAAGTCC
AGGAAAGAACTAACAATCAGTATTTGAGTATTGGCATTGGAGGAATGGTATTAAGTCTAT
AAGATTTGATGATTTACTAGATGTAGGCTCTGTAGAGCCTGTAACTTTGCTTCTGGTGGT
AGAGTATGGGATAAATTTTCCTCAAAGATCGTGTTACTATTTCATGTAAAGTTGAGATGC
TTCTGGGGCTAAGACAAAGCTAGATGTATTCTCAAATATGCACTTTCAGTTGACTCTCTA
CATTGTTAGTTACAGAGTTTACCCATCCCAAAGTAAGCATACCAATATGGGTATTCCTAG
GTATTCCATGGGCTCTGCCCAAGTGGCGTAGGGGAACATAGGTCTCTGCCCTGTGATGTA
CCGTCCCATTTCTGCTGCGTTGGAAATGAAGCTGGGCCTTGAGTCTGTGCCTGCATATTC
CTACAGCTTCTCGGAGTCCTATGGATGATGACTGAGGAGACAAACCATGAGGGAAACAGA
TCTCTAAGCACTCCCTATCTGGATCTAGGTTGATTGGAAATGAAAGAAAAATCTGCTTTT
ATCAGCTGCTATTCTACTGAATTAAGCTCTTACCTACCTTCTTTTGCAGTGGTTGCTCAG
GATTCCCGATAATTTATTTGATTTGAGGAGAGAAGAGGAGCCTTACCTAACATTGGCAGT
TGACACTTTACATACACTTTGGGGTCCTTTATTTGGCAAGGAGAGTTGGTAAAGTGATAA
ATGCCGTTTTTGTAAGATAAGCCTGGAGGTGTGGAAACTGGGGCCCATTTGACCCCCATT
AAAAACTGTCCTTTAGAGTAAGTCAAGGCGGGGGACAGTAGGTTAGAAAACCAAAGTAGG
AATATGAGTCTGGGGACTCATGAGGCCTCCATGAGTTAGGCATTCAGTTTCCAAAAGAGG
CCAGTAGCATGCTAACAGTTGCTTTAGAGAAGGAATATGCCTGATAAGTTGTGTCCTCCC
CTTTGTAAATCTTACTCAAACCCTATTGATTGAATCTGGATGTTCCCTCCCTTTATAGGT
AGGGTGGTGACGCCATGGGTGCCTCTCTGTATCTAGAAGAACCTTCAAGCTTTGAGTCCC
TCTCAAAAGTTCCTTAGGCAGTGTACTGGTCCTGTAGCCTTCAGTCCATAGGGGTCAGGG
AGACCTCAGCCCCATCCTTTATCATTTTTTTCTGCCAAGCAGGAGAATTTGGGAAGTAGA
AGAGGAGGGTGTAGATGGGAGCACCAAGGGAGAGAGCAGCTATACCAGTAATCAAAACTT
TGTGTTCACTTTTGGTTATTCCCTTATAGTTAAATCAAAGGAACTTCTAATACTTTTGGT
CCAACTAAAATTTCATTTTGGCAGCAAGGCCATCATTACTTACAAAATCTATTTTAGTTT
TGAGGATTCCATGGTTCAGCAGTCACAGCCACATTGCCTTTCATCTGGAGACACAAGGCT
TGTTGCCTCATTGTCTTGGCATATCCCTTCCTCTGCCAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved