Canis_familiaris Locus Mono:112:SNORA72
snOPY snoRNA Orthological Gene Database
Canis_familiaris Mono:112:SNORA72
Canis_familiaris
Mono:112:SNORA72
17
SNORA72
1001..1108
2108
GCTACCGCCCGCGTTGAGCCCGGCGAGCCAGGCGGGGCCTCAGAGCGGCTGGAAACCCG
GCAGCGACCCGCCCCGCGGCGTGCGGAGTCCCGGGGGGCCGCGGCGGGGACCCGGCGCTC
GGCTCAGCCGGCTGTCCCGGGGCGCGGTGCGAGGACGCTCCGTTAACCTCCTGGCTCGCT
CTGATACCGAAGCTGCATAAAAGGAAGGATGCCATGCAAATGAGGGCCAGTGTCGCGGAA
GGCTAAAGACTTTTAATTAAAGGAAGGCACCTGGAGACCCAGCCGGTGGGAGGAGGGAAC
TAGAGCAAGTCGGCCACGGGGAGCAAGAGTGTCGGCCCACGCAGGGCTCGCCCTCTTCGC
GGCCGCTTCTCCGCCCCCCCCCCTCCTCCCCGCAGAGGAGGACACTTGGAGGAGAAGAGG
GGCCTTTCCGTCCTTTGGAATAGTTCTGACATTGTGCCGCTGGGGCAGCACCGCGGGACC
CAACTCTCAGACTCCAGAATAGAAATTATCTGGAGGAAATAAATTGCCCCAGGCAAGTGA
GAAATAGAGTTGGACTCCCAGAACTGCCAGCGTCAAGACCTCTCTGCTGAGTAGCTGGAA
ATTCCAGGTAGCACTGAGGCCAAGGATAACATCTGGGGATGCCTTTCAGAGCCCACACTA
TTTTATTATCATGACCACCCCTACAAGCGTCAAAGCACTTAGCAAGCCCTGTGTCACGTG
CTTGACTTATCTCATTTAATCTACAACAACTCTCAAAATGTAGGTGTTCTTATCATCCCA
GTTTCACAGGGGGGACAGCTGAGGCCACAAGAGGCTAAGCCACTTGTTAAGGCCCTCCAG
TAAGTGGTAAAGCAGAGCCACCAAGACAATCCAGCTCCAAGATTCAAGATCTCAGGGCCC
TTTTCTTTAGGAATAAGAGCACCTAGTACGGCAGAAATAGCATACAGTCAGGACCTTGGA
CAGCATCTGTAGCTGGCGCTTACAAAGTAGATGCTCAGTTATTGTAATGCTCCTCCCAGG
CTAAACATTTACTATATATTAAGACCATGCATGTGTCCCCAGACCTAGTTCTGTTTCTAA
CTCTGGCTTTATTAATGCTGGTGATAAGTCCATCCTGACTCATGATTCATCTTATGTGGG
GAATGTCTGACCCTAGGTTATCTGATCAACCCTGAGAAATGACAACACAGCTAGTGTAAC
AACTTCAGAATAACCATTGCCAGTTTGAAGATTGCCACTTGCTTTAAATGAATTGTAAAA
CTAAAAGAATTTATGTGGGAAGGCAAAGAAAACTTGAATAGTCAAAATAATCCTGGGTAA
AAAAAGTTTTAGGATTCACACTACTAAATTTTAAGAATTACTATAAAGCCACAGCAATGA
AGATAGTATAGTATTGGCAGATGGAGAGATACATAGATTGATGGGTCTTAGGAGATTAGA
AATACAGTCATACAAATATGTCCAGTGGATTTTTGACAGAAGTGCAATAGCAGTTCAATG
GAGGAAAAAGAGAGTCTATTCAACAAATGATGTGGGAGAATGAACAAACACATGCCAAAA
CAACAACAACAATAACAATAACTAACCTCTAATAATTGTAATGCTCCTCCTCCCTTCCCC
AGACCTTCCTTTATATGTCAGTGGGTGGGGGTAGGGAAGGGGGGTGTTACCTTGGAGGAT
GATCCTGGAGAGATAAAACTTGGAACACAAAAATCACCCGCTGGGCCTGCAGAGCCAGGG
TTATGGGCAAGGGCATCTTAGATCTTAGGTGCCTGGACCCCAGCCTATAGACCAGTATCT
TTCCTGAAAGGTAACATGGCAAAGGATGAGAACTGTTTACTGTCTTTCCCTCTTTCTTTG
TGGAAAGGTGTACTAAGAACTTGAACAAAGCAGAACTGGAAACTCTGAACCCATAACAAG
TACCAGGGACCCAAAGTGGTCTTGGTTCACCTCAAGCTCCCTGACTCTGATTCACCTCTT
ATCACTTCTCAGACTTTTGGCTAAGATCAAGTGCAAATTCACCTCTGTTTTACTCTCTAC
ATACCAAGTGCTCAAGAATCTTGCAGTGTTAACAAGCAAATTTCTTATTCTCCTGCCTGT
TAAAACCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved