Canis_familiaris Locus Poly:22:SNORA71
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:22:SNORA71
Canis_familiaris
Poly:22:SNORA71
24
SNORA71, SNORA71
1001..1127, 2415..2547
3547
AGCCGGGCCGCAGCGTCTCCTCCTGTCCCCGCCGCGACGGTCCCGGTGCCCCGGGTGAG
TGACAGCAGGGCCGCGCTGCGCAGGGACCCCGGCGGCCTCCAAGGCTGGTGCTGCACTCC
TCTTCCCCCCGACAGGAGGGGAAACTGAGGCCCGGGGCGGGCGCGGAGAGCCGGCGGAGG
TCAGCCCCGGTTCCCGGCCCCGCTCCCGGCTCCGGGGCGGGCCTCTGCGGGCGGGTCCTG
GAGGAGGGGCTCCCGGGACGGTCCCGCTGAGCGCGGGCGGCGGGTGCGCAGCCGAGGCGG
CCCGCGGCCCGGGATGCGCCCCCGCCCCCGCCCCCGCCCCCAGCCGTCGGCCGGCTGCCT
ACCAGGTGAGCGGAGCCGCCTGGGCCCGCCTCGCGGCCCGCAGCGCTCGGGAGGGAGAGT
GCGCGAGCCGGGCCGTGCGGAGCGCGTGTCCGGGCCTCCAGTCGGCGGCGCCCGCGGGTC
CCGAGCGGCCGAGGGTGGTTCCCGCCTCCCCCCGCTCCTGGTGCCGGGGCCGGCGGGCTC
TGCGGGACCGTGACGCGCGGTGCCCGAGGCCGGCCCTGTGTGCAGGGGTGAGGCCTGGGT
AAGTGCTGCCGCGCGTGGGGGGGCGGGGGGGGGTCCCTGGAGCTCAGGCTCTGCGGGAGG
AGGCCGGAGGGGGCCGGGTTCAGATCGTGCCGCAGCCCGGGGCCGGCCACAGAACCTTGG
CTCATCACTTCCTGGTGCTGCGCTTCAGCTTCTTGCAAGTGCGGAGAGTGCCAGAGCTCT
GGAGGGACGAGAGTCCTTGCGGGTGTCCTTTGTCTTTGAGGCCACAGTGCCCGGCACGTA
GTAGGTTCTCAGGCTGCGTTTGTGGGGTGAATAAGCAGTTGAGGCGATCTTGCCGGGAGG
TGGTCTTCCTGTTGATGACGGGAGGTGGAATCTTTGCACCAAGTGCTGACGGTGCTCGGG
GTCCTGGGCTTGGCGGCGCAGCTTTCCCCTGCCTGGGAAGATAGCAGGCTGCGGACATGG
GCAGCCCGGGTCCAGGTCATTGATGGTGCAGAGAAAGGATTTTTTGAAAGCGCTTCCCCG
TGTTTGAAGGGACCCTTCCTGTCCCTTCCAAACCTGGAGCATTCTGCACTTTCTCTTTCC
TACCACCTTTTAGATGTCTCCTGTCACCTGGTGCCAATGTCGTGCTCATTGATGGTGCAG
GGAGAAGATTCAGGGGAGGGTTGTCCTCTGTTTGGAGGATCCACATCCTCACCTTCCAGT
TTTACCACGTTCCATCTTCTCCGCAGACACCTTGGGCCTCGGGGGCCCTGTGTGTGCATT
AGTGTCATTGTTGGGGCTTTCACTTTCTGCCCCTGCTGTTGGGAACCAGGCTATGTGTGT
TACTGGAGGTTTCCTTGATGCCCAGTATAAGTGCTGTGGGGCAGCCATGGTATGCTCCTG
TATATCTAGCCTTGGCCTGTCACTGCTTAATGAAGCGTTAATCAGCAATGGTCACCCTAT
CGTAGAGCACACACTGTCTCCCTCTTCAGAGTTAACTACTGTCATTTCTATGAGGAGATA
CGTAACGTGTTAAGGAAATAACAAGAGCCAACATTTGTCAAATGCTTGGTTTATCCAATA
ACTACTGTGTTAAGCCCTTTCCTGATGCCTAGCGTGCCCTGCTGTGAGCAGGGACAAGTT
GGATGCCCATTCTTGGGTTCTTGTCTGTTGCAGATGAGCCCACTGTGTGCAGAAGTGTCA
TGGTTGTTGTATCAGGAACATTCTAGACCCCAGTGTCCTTGAGGTAAGATCTCTTGTTTC
TTCTCTGGAATGTTGGTTCCTTGCATCTAGTACAGTCGTGTGTGGGTTCCTAGGGGCTTT
GTATGAATGTATAAGGGAACTGAGAGGTGAGAAGGTAATGTCTATGAGTCTCCAGATCTG
CTCCCTCAATCCCAGGCAACCTAGATCACATCTGTCCTTTAATACGTCCTCAGGGCTGCT
GCAGAGGAAGGGCCTCCAGGGTCTCACTGGGTAATGAGAGCTCTCTAGGACAGCAGAAGC
ATGTTGTGATGGGAAATGGCACCCTCATATTGGAGACTCCTGTCCCTGGCTTTGAATCCT
CTTGTGCTACTCTCTCAGTGACCTGTTCAGAACCTTATTTTCTTCATTTAAAAAACAAAC
TTAATCATAGAGATGACTTCTGTGCTGCTTAAGACCACAGGATTCCTATCATTTCCAGCC
CTAATATTTTCCCAGCATTTTTGCCCAAAGTGACTTCTCTTTGATTCCCTTTGGCAGGGA
GGTTCTATGGGGCTTTTGCAAGAATGGCTACTCTTGAGGTCCTGTTTTGGCTGGGTGATT
GTCCCAGATTCAATATATTCCAAAGGCCAGTAGCACCTGCTTCTCTTCCTAGGTCTCTCT
CTCTGCCCTTCTCGCACCTGCATTCAAGAGCGATCATGGGCTGTCTGTGCTCTGGTCATT
GATAATGCAGGGAGAGGAATTGTTGAAAGCAGCTTCCCGTGTTTGGAGGGTCCACACTGT
CCCTTTCAAATGCTGGTGCTTTCACACAGTCCTGCCCATCTCCAACTAGTGCTCTCTGGT
CTCTGGCATTGAGCACTGCCTTGTGAGAGTCCATGATGGGACACTTTAGCTTGGCCTTGT
TCAGCTTGGCCTCCTATTGTGGGAAACCGGGCTCTGTTTTTTTTTAGATACTTTACAGGG
TTTAAGGAGCCAGGATGAATTCTGCATAATGACACTGTGCAATACTGAGTGGTTTATACT
GATTGCCATAAGATTTTCAAAAGGTGGCAGCCTTTTGGATTTGGTGGCCCCGGGCAGACC
TTCAAAGGGGTGGGTGTGACGGGAAATGAGAAGGTATTGGGTGGGAGTGGGGAGAGCAAC
CTGGGGAGGAGTTTGGCGCTGAGGTGAGCACAAGCACCGAGGAGACAGATGCAGGGGTGT
ATGTGTAATGACAGCAGGCTGAATTAGTGACCTTCACTCCCAGTGTGGGATGGGGATGGG
TGGCGGGCTCAGTGGAAGAGTCTCTGAGCTTGAGCTCTCCCACCATCTCTACCAATTACT
GTATCTGTTCTTGCCCTGAAAACGCCCCTTCTTTAAGGTAGTGTTTATTTTGACTCTTCT
GGGAGCACTAAGATTCATTTTTAAGTTGTGTTTGGTGTGAAAAATAACCCAGCAGCTCAT
GCCTGATTAATTGGGACATTCTCATTGATCATTGATAACAGTTTGGAGAAAGATGAGATC
ACATTGGAACCCAAACACCTGTTGTGACCACCTGCCCTGTGGCGTCGTCCTTACTCTAGG
AGGGCTGCCTTGGATCTGGAGATTGTTGGAGGAATTCTGAGGGGATGGAGGCACTGGTGC
TCTCGGATTGACCTTGGTCCCAGCTGTCCTGGAGGGACCTCATCATGGTGAGTTAATGGG
GCTTAGCAATGGGGCTAAGTTGGCCTGTGTTTCTGACATGGAAATTCTGGACTGCTGGCC
TCATTGAACTTTCTCCTTTAGATTGTCGTTTGGGTGGATCATGGACATTGGAGTAGCATA
ATGAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved