Canis_familiaris Locus Poly:13:SNORD115
snOPY snoRNA Orthological Gene Database
Canis_familiaris Poly:13:SNORD115
Canis_familiaris
Poly:13:SNORD115
3
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2649..2718, 5393..5473, 7582..7662, 9226..9305
10305
ACAGGCTGCAGCCAACTTCGGGGCCAAGGGGAGGCAAGCCTGAAGGTGACACGAGACCC
AGCATCCAGGTGAAACACCTGCAACACCAGAAAATGTTGACAGTTCCAGGAAGGTCTGGC
ATCACCAAGGTGCAGGAATAGGTGGACCAATAGGTGGCCAGGACAGCCCAGAGGGAACCC
AGTGTCCCAGGCAGGGCGGCTGTGCCAGACCAAGTGGAGCTATGGGCTTCTACTGCCCTT
GGCTGCCAAGATGGCAAGGGCTGACCCTGGACCTGGTAGGAGGCACACAGGTGAGCCTTT
GGGTCAATGGAGATGGTGCTGGGCCCCAACCATGGGTACTTAAACTGACGGGGCCACTCA
GGGAGCCCTCCCTCCCAATCTCAGACAGGGATCACTAGCTTGGGCGGCAGGGTGGAGTTG
CTAGAATTCAGCGTGCCCTGGGCCATCCCATGCTGCCCTGTGCCCTGGGTCCCAGAGTCC
TCCAAAGCCCAAGGCCCACCCCGACCATCCTGCTATGACCAGAATGAGGGCTAATTCCAA
GTCCATCCCCTCCCTGGCATAGCCCAAGACCCAACACAGGTCCAAATGGGAAGCCTTGGT
GTTTGGACGGCTGCTGCAGGATGGTAGGCACATATGCTCAGCACCATTTGGGGGAACCCT
TGAACTGAGGCTTGTTAAATTTGACATGGGGTCCAGGGTTGCACCCTATCAAAATACTTC
TGGTCCCGAAGATGGGCCTGAAATTAACGTACAGAGCACTGAAATATGCTTGACCCACCA
CAGCTCTGCACCCTGGGATAGCTGCCACAAGGCTGACTTCTAGACGACTGGCATTCTCTC
TGCCAAAGGACACCAAATATATTAACCCATCCTGCCAAGCCCTCCCAAGGCCACCTCAGC
TTGGTCAAGGTGAACTGAAGTCTCCAGCCAACCAAGCCCTAGAAGCAAAACCAGTAAGCC
ACTTCAGGGTGAAAGGCCTACAACGTGGAGAGTGCTGTGCTGTGTCAATGATGAGAACTC
ATATTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGCTTACACTGACAC
CCAATGGAGGGGACCAATCCCAGCAGAGGATATGGGGACTCCAAATGGTGCTGGAGGTGC
TTCCACTCAGCCTGGGCTTTGAGGCCCCCAATCCTTTCAAATTGCCCATTGGACCTGGGG
CCTGGACATGGGCTTCCGAGTGCCTGAGAAGGTTAGGGCTTTCGGGCCTGGGTGCTGACC
CATTGCTCCTTCCACCACACCTCCCCTGGGGCCCTTGCTCAGCCTCTCTGGTCCCCTTGT
GTCTTTCAGGAGGCCATGCTAGCCAGGGTCTCACCACCGCCACAACTAAGCTTGGTGAGT
GGATGCCACAAGGCCGGTTGCAGGCCTAGGTGACCTGGAGGTCTTAGAGAGGAAAGCCTG
AGGGGGACTTGGGTCCCTCTGTGCAGGCCCACCAATGCAGGGATGGATAGCGTTCCTGCC
ATTTGAAGGCCTGCCATCCCCCAAGGAGCAGGAAGGAGTGGACGCAAAGGTGGCCAGGGG
AGCCCAGAGGGGCCCCAGTGTGGGTGGCTGGGGGGACACACCAGGCAACAAGAAGCAGGG
GACTCCTGCTGCTCCCTGCAGATCAACAGGGGCACCACCTCAGTGGACTTGGGGTCCCCT
CTCCTGTGAGAACCTGAAGCTTCTTGGCTGGTCCGTACTGCATCTAGCCAACTCTGCTTG
GGGTGGAGCCCTGGGCTGGTAGCCACCAATGTCCCCTGGGGCCTACCGCCTCCCAAGGAG
GTTGGGACTGGTTGATCAGGGGGAAACTGGTTCCCTCACCTGGCCTTGGAATTCCGGAAG
GGAAGGGCAAGCTGGGGCCCTGGGATGGGCATCCGGGCATACATTCAGGCCATTGGGGAT
GGCCAGGGACCCAGGCCTGGGCCCTCTAGAGCTGGTGGCTATCCCGGGTGCTCTTGCTCC
CAGTCCCAGACAGGGATCTCCTTGCTTGGGTGGAGGGAGGGGTTGCAGGAATTCAACCTT
CCCTGGGGCCCTCCAATGATGCCCAAAGGACTGGCTCCTCACATCCTCGAGGGCCCCGAG
TCTACTAAGGCCATATACCCCTGACCAGATTCTGGGCCAAGGCGAGGTCTGAGCCATCCT
AGTATTGGCCCGCCAAGTTGCCCACCACCCGCAACCCAAGGGGTACCCAAGGGAAACCCT
GGTGCTCAATCTGCTGCCTGGTGGTGGCCCAATTGTTCAGCCACCTTGGGGAGCCCTAGT
CTGGCTATTGTGTCTCCCAGCACAGCTTCGGGGCCATATGCCCTCTGGGATCTCCTGTGT
TTCCACCAGGTGGGCTGCCAGTTTCAATCCTGAACACCCAATGCCTCACTGAGTGCCTAT
GGCTCTGCTCCACAGGGGAGCTTAGCTGCCATCTGGATGGCCGTCTAGACGGAGGGCTTG
CTCCTATCACCCCAGACTCCAAACCCAATTGATCATGCCACTGCACCCTTCTGCACACCA
CGTCAGCTGGGTCCAGTCTTAAGAAGAGTTCCAAGGGCTACAACACACAAGGCATGCCGC
TTGGCAGCAAGCACCACTGGTAAGCTGCTTCAGGGATAGATGCCCACACACGTGCCCAGT
GCTATGCTTGGGTCAATGATGAGAGCTCATAATGTCTTGAAGACAGATGATGATGCTCAC
TAGGATTACACTGAGGCTCAATGGAAGGGACTGCCCAGGGCTGCAAATACCGGGCGGGTC
TTCATGTGACACTAGGGGTGCTTCCCCTCAGCCTGGGCCTTGAGGCCCCCAAACCTTCCA
AACTGCCCATCAGGGTTGGGGCCTGTCCATGGGCTTCAGGGTGCTTGAGAGGGCTCAGGC
CTTTGGGCTGGGTGCAGACACATCGCTTCTCCCACCATGCCTCCCCTGGGGCCCTTGCTC
AGCCTCTCTGGTCCCCTTGTGTCTTTCAGGGGACTGCGCTGGCCAGGATCTCGCCACCAC
CTCAACAAGGCTTGGTGAGTGGATGCTGTGAAGTGGGTCACAGGCCACGGTGACGAGAGG
GCCTTTGGGAGGCAAGCCTGAGGGCGACTTGGGTCCCTTGCATGCAGGCCCAGCCATGCA
TGGCCAGATAGTGTTACTGACCTTTGAAGGCCCACCATCCCCAGGGCGCAGGGAGGAATG
GGCCCAAAGGTGGCCAGGGCAGGCCAGAGGGAACCCACGTTGGGCTGATGGGGGGCCAAG
CCAGGCCACGGAGAGCAGGGGACTCCTGCTGCTCCTTGCTGATCACCAAGGGATGCCACC
TTGTTGGAACTTGGGTCCCCCCTCCTGTGGTGGACTGATGAGACACATGGCTGGGCCGTG
CAAGGTTGAGACACTGCTGCTTGGGGTGGTACCCTGGGCTGGGATCCACTGACCTCCCCT
TGGACCTGATGCCACCCAGGAGGTTGGGACTGGTTGCCCAGGGCAGGAGCCTAGTTCCCT
GACTTGGCCTTGGCAACTGGGAGGGCAAGGGCTAGCTGGGGCCCTGGGGTGGGCATCCTG
GAGGGCTTTGGGTGGTGGGGATGGCCCAGGGCTCCAGCCCCTAGACACTGAAGCCCTGGC
GACTGTCCCAGGTGCTCTGGCTCCCAGTCCCAGACAGGACACACCCTGCTTGGGCAGAGG
GTGCAGTTGCAAGAACTTGACATGCCCTGGGGCCCTCCTATGAGACCCAAAGTCTTGGGT
CCCCAAATCCTTGAGGGCCCTGAACCTACTAAGGCCATATGCCCTGAACAGATTGCCGGC
CAAGGCCAGGGCCCAGCAATCCTAGTCTTGCCCATGAAGTTGCTGGCCACCCACAACCCA
AGGGGTACCCAAGGGAAACCCTGGTGCAGACCTGCTGCCTGGTGTTGCGCCTCATTGCTC
AGAACCCCTGGGGGGCCCGCATCTGCTATTCATGTATCCCAGCACAGCTTCAGGGCCACG
TGCCCTCATGGGCCATCCTCTGTTTCCAACAGGTGGGCTTCCCACCTTACATCCTGAAAC
TAACCCTCAATGAGCTCGCACATCTCTGCTCCACAGGGAAGATTAGCAGCCACCCGGAAG
GTCAACTACATAGAGGGCTTGCTCCGATCTGGACTGAATATGAATGCAGTCGATCATGCC
GCTGCACTGTTCTTCACACCACGACAGCTGGGTCCAGTCTTGACAGGAGGCCAAAGGCTC
CACCCACAAGGCACATGGCTTGTCAGCAACAACACAGGTAAGCTGCTTCAGGGGTAGATG
CACACACACATGACCAGTAATGTACTTTGGCCAATCATGAGTACTTATATTGTCTCTAAG
ACATGATGACATAAAAACCAACTCAAAAAAATATGCTAAGGCCCAATGGAGGGGACCATC
CCAGGCTGAAGATATGGAGGCTAGAAGGGAGCTGGGGGTGCTTCTCCTGGAGTTGCAGGC
CACAGGTCCTGCCAAATTGCAAGGAGGGCTGGGGCCTGGCCATGGGGCTCCAGTTGCCTG
AGTGGGGTGAGGCCTTCGATCCTGGCTGCAGAGCATCCGTCCTATCATGACAGGGAACCA
TTACTCAAACTTTATGGTCCCCTTGTGTCTTTCAGAGCACCAGTGTGTCCAGGCCACATC
CACCAACAAGCCCGATGCCCTCTGCAAGTCCGGTTGACACAGGGCAAGAGCCATGAGCAC
CCAAGCTCTGGCAGCCTTCCCGGGAGCTCTCGCTCTCTGGGCACACAGGGATCTCCCTGC
TTGGGCGGACGGTGGGTCTGCCGGGACTCGACGTGCCATGGGGCCCTCCCATGACGCCCA
AAGGTCTGCCTCCCCGAGCCCTCAAGGGCTCCGCATCTACTAAGGCCATACTGCCCTGAC
CAGAATGCCGGCCAAGGCCAGGTACCAGCCATCCTGGTCTCAGCCCGCCAAGTTGCCCAC
AGCCCGACCACCCAAGGGGTACCCAAGGGAAACCCTGGTGCCCAACCTGTGCCAGGCTGT
GGGTCCCGTGGCTCAACCCCCTTGGGGGAGCCTTCGTGTGGCTGTTCGTGTATACCAGCA
CAGGCTCGGGGCCACGTGAACACTTGGGCCCTCCTCTGCTTCCACCAGGTGGGCTGCCCC
CCGCAATCCTGAACCTCGAAATCCTCGTTGAGCCTCCTCCTCTCTCAGGGAAGTCCACAG
GGAAGCTTAGCGGCCACTCAGATGGGCGTCTAGACGGAGGGCTTGCTCCTATCCCAAAGA
GGCTGGACCCGGTCGATCGTGCCGCCGCACCCTTCTGAACACTACGTCAGCTGCGTCCAC
TCTTGAGAGGAGGATCAAAGGCTCCAGCCCAGAAGGCACGAAACTCATCAGCAAGCACTG
CCAGTAAGCCGTTTCAGGGGCAGACGCCCACACACGTGGCAAGGGCTGTGCTTGGGTCAG
TGATGAGAATTCATATTGTCTCGAAGAGAGATGAGGACTTAAAAATCATGCTCAATAGGA
TTATGCTGAGGCCCAGTGGAGTGGAGTGGACCGTCCCGGGCAGAGGATCCGGGTGCTCCG
GTTGTGCTGGGGGTACTTCCCCTCAGCCTGCAGTTTCAGGCCCCGGATCCTGCCAAATTG
CCTTTTGCGGCTAGCATCTGGACGTGGGCCTCTGTCGGCCCGAGAGAGCTTAGTCGTTCA
GGCCTGGGACCGACCCACCACTCCTCCCACCACACCTACCCTGGGACCCTTGCTCAACCT
CTCCGGTGCCCTTGTGTCTTTCAGGGGGCCGTGCTGTCCGGGCCCTCGGCCCCGCCTCAA
CTAAGTTTGGTGAGTTGATGCCACGAGGCGATTCAAAGTCCAGGGGACCAAGGGGCCTTC
GGGAGGCAAGCCTGAGGGTGATTTGGGTCCCTGTGTGAAGGCCAGGCCCACCCGTGCAGG
GATACATAGTGTCGCTGCCTTTGAAGGGCCACCATCCCCTGGGTGCAGGAAGAATGGGCC
CAAATGTAGCCAGGGAAGCCCAGAGGGACCCAGCGTGTGCGGCTGGGGTGGGGGATGGGG
GACAAAACCAGGCTGCGGGAGGAGGTGGACTCCTGTTGCCCCCTGTTAATCACTATGGGG
TGCCCCTCGGTGGACTTGGGGTCCCCTCTCCTGTGGATACCTGGAGCCCCTCAACCGGGA
CGTGCAGCGTCTAGCCACCGCTGCTTGCGGTGGTGCCCTCGGCTGGCATCCCCCGGACAT
CCCCTGGGGCCTGCCCCCTGCCAAGGAGGTTGGCAATGGCTGCCCAGGTCCGGGGTCTGA
TTCCCTCACATGGCCTTGGCATTGTGGAAGGCAAGGGCTCGCCAGGGCCCTGCACTGGGC
ATCCGGACGTGCCTTTGGGCCACTGGGGATGGTGCAGTGCCCCAGTCCTGGGCCCTAAAT
CTCTGGAGGCCATCCCGGGCACTCTCGTTCCCAGTCCCACTCATGGCTCTCCGTGCTGGG
CCGAGGGCCTGGTTGCAGAAAGTCAGACCACCCTGGGGCCCTCCCTTGATGCCCAAAGCC
CTGGCTCCCCAGTCCTGAGGCCCTCGAGTCTACTAAGGCCATACTGTCCTGACCAGATGC
CCAGCTGTGGCCGGTCCCCAACATCCTAGACTTAGTCCGCCAGGCTGCCCGCCACCCACC
GCCCACAACCCCAGGGGTTCCCAAAGGCAACCTTGGTGCCTGACCTGCTTCCTGGCGTTG
GGCTCCTTTGCTCATGCCCCTTGGTGTAGCCCTCGTCTGGCTCTTTGTGTACCACGGCAC
AGCTTCGGGGCCACTTGCCCTATTGGGTCTTCTGTGCTTCCACCAGGTAGGACTCTCGCC
TCAATCCTGAAACCCCAAACCCTCGTTGAGCCCCCACGGCTCTGTTCCACAGGAAAGCAT
AGCAGCCACCCAGATGGGCGTCTAGACGGGGGGCTTGCTCCTAACCTCTGGAGGCCATCC
CGGGCGCTCTCACTCCCAGTTCCACTCATGGCTCTCCATGCTGGGCGGAGGGCCTGGTTG
CAGAAGTCAGACCGCCCTGGGGCCCTCCCTTGATGCCCAAATCCCTGGCTCCCCAGTCCT
GCCGGCCTTTAATCTACTAAAGCCATTCCGCCCTGACTAGAATTTTGACAAAGTCCTGGT
GCCAGCCATCTTAGTCTTTGCCTGCCATGTTGCCCACTACCCACCACCTGAAGGGACCCA
AGGGAAACCCTGGTGCCCGACTGGATGTTGGGGTGTGGGCCCCATGTTTTAGTCCCCTTT
TTGTAGCTTTCCTCTAGCTCTTTGTGTATCCCAGCACATCTTTGGGGCCACTTGTACTCT
TAGGCCCTCCTCTGCTTCCACCAGGCAGGCCATCCACCTCAATCCTGAACCCCCAAACCC
TCGTTTATCCCCTATGGGTCTGCTCCAGTTGAAAGCTTAGGTCCCCCCAGGATGGGTGTC
TAGACGGAGGGCTTCTCGTATACCCACAGACTCTGAACCCAGTTGATCGTGCTGCTGCAC
CCTTCTGCCCACCAAATCTCTTGGCTCCTGTCTTGAGAGGAGGATCAAAGGCTCCAGCAC
GAAGGCATGTAGCTCATCAGCAAGCACCGCCAGTAAGCCGTTTCAGGGGCAGACGCCCAC
ACACCTGGCAAGGGCTGTGCTTGGGTCAATGATGAGAATTCATATTGTCTCAAAGAGAGA
TGATGACATAAAAATCATGCTCAATAGTATTATGCTGAGGTCCAATGGAGGAGACTGTCC
TGGGTGGAGGAATCGGGTGCTCCAGTTGTGCTGGGGGTGCTTCCCCTCAGCCTGGAGTTT
CAGGCTACGGGTCCTGCCTAATTGCCCTTTTTGGCTAGGGTCTGGACATGGGTCTCTGTC
TGCCCTAAAGAACTTAGTCCTTTGGGCCTGAGGGCCAACCCTTGCTCCTCCCACCACACC
TGCCCTGAGACCCTTACTAAGCCTCTCTGGTGTCCTTGTGTTTTTCAGGGGGCTGCGCTG
TCCAGGCTCTCACCCCCTCCTCAACTAAGTTTGGTGAGTTGATGCCACGAGGCGAGTCGA
AGTCCAGGGGACCAAGGGGCCTTCGGGAGGCAAGCCTGAGGGTGATTTGGGTCCCTGTGT
GCAGGCCCACCTGTGCAGGGACACATAACATTGCTGCCTTTGAAGGCCTCCCATCCCTAA
GGTGCAGGGAAGAATGGGCCCAAATGTAGCCAGGGTAGCCCAGTGGGACCCCAGTGTGCA
CAGCTGGGGGGCAACTGCAGGCCACGGGAGCCAGCGGACTCCTGCTGCTCCCTGCTTATC
ACTATGGGGCTCTGCTTCGGTGGACTTGGGGTCCCCTCTCCTTTGGGGCCCTGGAGCCAT
CATCTGGGCCTTGCTGCATCTAGCCACTGCTGTTTTGGGTGTTTTCCTGGCCTGTGAGGG
CACTGACCTCCCCTTGGACCTGCCGCCTCCCAAGGAGGTTTGAACTGGCTGCCCAGGGTG
GCAGCTTGGTTCCTTCAACTGGCCTTGGATCTGGAAAGGCAAGGGCTAGCTGGGGCCATG
GGGTGGGTATCCAAGCATGCCTTTGGGCCATTAGGGATGGTGCAGGGCCCCAGCCCTGGG
CCCTCAATTGCTTGCAGGCATCCCGGGCACCCTTCCTCCCATTTCCGGACAGGGCTCTCC
CTTCTTGGGCAGAAGGTGGGGTTACAAGAACTCCGCATGCCCTGTGGCCTCCCAAGATGC
CCAAAGGCCTGGCTCACCATGTCCTCGAGTGCCCCAAGGTTACTGCAGCCATATGATCCT
AAACAGATTGCTGACCAAGACCAGGTCCCAGCCATCCTACTCTTGGTCTGCCGTGTTGCC
TACCACCACAATCTGAGGGTTACCAAGAGAAACCCTGGTGCCCAACCTGCTGCCGGTCAG
TGGGTCCCATTCCTCAGCCCCCTCAGGGAAGCCCTCAATGGACTATTCGTGTATCCCAGC
ACAGATTTGGGGCCACATGCCCTATTGGGCCCTTTTTTGCTTCCACCATGCAGGCCATTC
ACCTCATCTTGAACCCCAAAACCCTCATTGAGCCCCCACGGGTCTGCTCCAGTTGGAAAC
TTAGCTGCCCCCGGGATGGGCTTCTTGATGGAGGGCCTCGTAGCCCCACAGACCCTGAAC
CCAGTGGATCATGCCACTGCACCCTTCTACACACTACATCAGCTGGGTCCAGTCTTGAGA
AGAGGCCCAAATGCTCCAGTCCACAAGGCATGCAGCTCAGCATGAAGCACCACCGGTAAG
CCTTTTCAGGGGCAGAGGCCCACACACATGACCAGTACTGTGCTTGTGTCAGTGATGAGA
ACTCATATTGTCTCAAAGAGAGATGATGACATGAAGATCATGCTCAATAGGATTAAGCTT
TGGACCAATGGAAGATATTGTTCCATGCTTAGTATTCTGGACCTACAGTTGGTACTGGGT
ATGCTTCCCCTCCGCCTGGGCCTTGAGGTTACCAATCTTTCCAAACTGCCCTTTATGGCA
AGGTCGTGGCTTTGGGCCTCTAGGTGCCTGAGCTGGCTCAGGCCTTTGGGTTGGTCCCAA
CCCATTGCTTTTCAGTCATGCCTCCCCCTGGCTTCTTGCTCTGCCTCTCTGGTTCCTTTG
TGTCTTATTGTACCATGCCTCCTGGGGTCTCGCTTCTACTTCAATCATATAGGTTTGTAT
GCCATATTTATAGTCTACAGGCTGCAACCAACCTCGATTTTCAGAATCTTTTCTTGTGAG
ACTCGTGCCCAGATGTATAGCTTGGACTGCTGCAATACCTGAAATGGTTTAGTGCCTTAG
GAAGATCTCCCCCTCCCTAGAGCACTGGAACATGCTGGCCAAATGTGGCCAGGGCAGCCC
AGAGTCACTTGCATGTGCCATATAGGGAGGTACCATGCCAGGCCATTTGGCTTTGTGTGC
TTCAGCTGCTCCCTGTTGAGAATGATGGTGGACCTCCTGGGTCAACGTTAGATCTCCTTG
GCCAGTTTCAGCCAAGTCCCTGTTCTGTGCCATGCTGATGGAGCTACTTCTACCTTGGAG
GGTGCCATGGGCACAGATAACACGAACTTCCCCTTACAGCTAGCCAGCTCTGAAGTATGT
TCAGAGCGGCCTGCACCATCAAGGGACCTGGCCTTGGCTGCTGGAATGGTAACACCAACC
CAGGGCCCATGAAGGCACCCCCGGGCATGCCTTCAGGCCATCGGGGATGGTGTTGGACAG
TAGTCCTGGACATCAACTCCAGCGGCTGTTAGGGGAGCCCTCACTCCCAATCCTGAATAG
GGCTCTGTCTGCTTGGGAAGCATGTTGTGGTTGCATGAACTTTAGTTTTCATTCAGCTCT
CCTGTGGTGCTGGGTGGCCTGGATTCCCAAGTCTTCTAGGGCTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved